Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630141_at:

>probe:Drosophila_2:1630141_at:196:537; Interrogation_Position=1350; Antisense; GGAGACGGCGCAAAGGGCTTTTCCT
>probe:Drosophila_2:1630141_at:512:219; Interrogation_Position=1362; Antisense; AAGGGCTTTTCCTTCACCAACAGTG
>probe:Drosophila_2:1630141_at:384:561; Interrogation_Position=1404; Antisense; GGAAACATTCATCCGCCAGCTGCAG
>probe:Drosophila_2:1630141_at:717:435; Interrogation_Position=1497; Antisense; GAGGATGACGCTATATACTCCAAGC
>probe:Drosophila_2:1630141_at:184:145; Interrogation_Position=1513; Antisense; ACTCCAAGCGGTGTAAGGTGTTCAT
>probe:Drosophila_2:1630141_at:77:575; Interrogation_Position=1566; Antisense; GGCGTGGGCACGTTGTACTTGAAAC
>probe:Drosophila_2:1630141_at:531:721; Interrogation_Position=1584; Antisense; TTGAAACCTGTCAAGGACTCCGAAA
>probe:Drosophila_2:1630141_at:242:171; Interrogation_Position=1607; Antisense; AAAGATCCAACTGTTAGTCCGCGCC
>probe:Drosophila_2:1630141_at:301:39; Interrogation_Position=1639; Antisense; ATCTGGGCAACATCTTGGTCAACCT
>probe:Drosophila_2:1630141_at:319:223; Interrogation_Position=1674; Antisense; AAGGGTATACCTTGCCAGCGCATGG
>probe:Drosophila_2:1630141_at:399:161; Interrogation_Position=1705; Antisense; ACAATGTGCTGATGGTCTGCGTGCC
>probe:Drosophila_2:1630141_at:207:101; Interrogation_Position=1736; Antisense; AGAGGACTCCAAGGCCACATCGCTG
>probe:Drosophila_2:1630141_at:536:257; Interrogation_Position=1751; Antisense; CACATCGCTGTTGCTACGCGTAAAG
>probe:Drosophila_2:1630141_at:223:411; Interrogation_Position=1782; Antisense; GACGAAGCCGACGACTTGCTGGAGA

Paste this into a BLAST search page for me
GGAGACGGCGCAAAGGGCTTTTCCTAAGGGCTTTTCCTTCACCAACAGTGGGAAACATTCATCCGCCAGCTGCAGGAGGATGACGCTATATACTCCAAGCACTCCAAGCGGTGTAAGGTGTTCATGGCGTGGGCACGTTGTACTTGAAACTTGAAACCTGTCAAGGACTCCGAAAAAAGATCCAACTGTTAGTCCGCGCCATCTGGGCAACATCTTGGTCAACCTAAGGGTATACCTTGCCAGCGCATGGACAATGTGCTGATGGTCTGCGTGCCAGAGGACTCCAAGGCCACATCGCTGCACATCGCTGTTGCTACGCGTAAAGGACGAAGCCGACGACTTGCTGGAGA

Full Affymetrix probeset data:

Annotations for 1630141_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime