Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630142_at:

>probe:Drosophila_2:1630142_at:471:623; Interrogation_Position=3951; Antisense; TCCACGTGACGGATGGGATCCCAAT
>probe:Drosophila_2:1630142_at:574:441; Interrogation_Position=3962; Antisense; GATGGGATCCCAATCCAGTATCAGA
>probe:Drosophila_2:1630142_at:529:629; Interrogation_Position=3975; Antisense; TCCAGTATCAGATCCTTGGCGGCAG
>probe:Drosophila_2:1630142_at:180:529; Interrogation_Position=4000; Antisense; GGGAGCGAACCAATCACTCACTCAC
>probe:Drosophila_2:1630142_at:78:129; Interrogation_Position=4027; Antisense; ACCACCACTCAGTGTACTCAGTGTG
>probe:Drosophila_2:1630142_at:687:513; Interrogation_Position=4038; Antisense; GTGTACTCAGTGTGCACCACCCAAA
>probe:Drosophila_2:1630142_at:39:107; Interrogation_Position=4121; Antisense; AGACAGCCACAAAAGCGAGCGCGCA
>probe:Drosophila_2:1630142_at:590:173; Interrogation_Position=4132; Antisense; AAAGCGAGCGCGCACACAGACTTGT
>probe:Drosophila_2:1630142_at:577:549; Interrogation_Position=4161; Antisense; GGAGTTGCATAGATCGTTGTTGCTA
>probe:Drosophila_2:1630142_at:279:293; Interrogation_Position=4175; Antisense; CGTTGTTGCTATCTTATCATGTGGC
>probe:Drosophila_2:1630142_at:506:425; Interrogation_Position=4324; Antisense; GAGAGCTAATGAGATCCTTGGAAAA
>probe:Drosophila_2:1630142_at:393:509; Interrogation_Position=4363; Antisense; GTGCAGTTTGCTTTAAATTCTCCAG
>probe:Drosophila_2:1630142_at:487:713; Interrogation_Position=4380; Antisense; TTCTCCAGCGCAGAATTTTCTATTG
>probe:Drosophila_2:1630142_at:410:611; Interrogation_Position=4416; Antisense; TGAATTTCTTTTCGCAGTTACCCCA

Paste this into a BLAST search page for me
TCCACGTGACGGATGGGATCCCAATGATGGGATCCCAATCCAGTATCAGATCCAGTATCAGATCCTTGGCGGCAGGGGAGCGAACCAATCACTCACTCACACCACCACTCAGTGTACTCAGTGTGGTGTACTCAGTGTGCACCACCCAAAAGACAGCCACAAAAGCGAGCGCGCAAAAGCGAGCGCGCACACAGACTTGTGGAGTTGCATAGATCGTTGTTGCTACGTTGTTGCTATCTTATCATGTGGCGAGAGCTAATGAGATCCTTGGAAAAGTGCAGTTTGCTTTAAATTCTCCAGTTCTCCAGCGCAGAATTTTCTATTGTGAATTTCTTTTCGCAGTTACCCCA

Full Affymetrix probeset data:

Annotations for 1630142_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime