Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630145_s_at:

>probe:Drosophila_2:1630145_s_at:620:87; Interrogation_Position=545; Antisense; AGTCGTTCCGACTACATGGACGCGA
>probe:Drosophila_2:1630145_s_at:628:65; Interrogation_Position=560; Antisense; ATGGACGCGATTCAGATCAGCATGA
>probe:Drosophila_2:1630145_s_at:584:185; Interrogation_Position=659; Antisense; AACAACTGCCGCTGGGAGACCGTCT
>probe:Drosophila_2:1630145_s_at:486:75; Interrogation_Position=699; Antisense; AGGTCACCTTCGTTGAGTTCTGGGA
>probe:Drosophila_2:1630145_s_at:143:401; Interrogation_Position=722; Antisense; GACAGGAACAGCGACATCATCAAGT
>probe:Drosophila_2:1630145_s_at:273:37; Interrogation_Position=737; Antisense; ATCATCAAGTATGCCGGTCTGGTCA
>probe:Drosophila_2:1630145_s_at:316:271; Interrogation_Position=760; Antisense; CATCGCCGCCATCGAATTTGTGGGA
>probe:Drosophila_2:1630145_s_at:643:243; Interrogation_Position=774; Antisense; AATTTGTGGGATTCGTTTTCGCCTG
>probe:Drosophila_2:1630145_s_at:188:469; Interrogation_Position=798; Antisense; GTTGCTTGGCGAACAGCATTCGGAA
>probe:Drosophila_2:1630145_s_at:448:411; Interrogation_Position=828; Antisense; GACGCCGTGCGGAATATTAATCGAC
>probe:Drosophila_2:1630145_s_at:597:403; Interrogation_Position=857; Antisense; GACTAAGGCCTTGCACTAATTTTAA
>probe:Drosophila_2:1630145_s_at:435:393; Interrogation_Position=890; Antisense; GAAAGTACGAATTATGTTGCCCAAT
>probe:Drosophila_2:1630145_s_at:418:699; Interrogation_Position=925; Antisense; TTTACCTGATACAGATGGCCATTCA
>probe:Drosophila_2:1630145_s_at:238:365; Interrogation_Position=999; Antisense; GAATGCGTAACGATCACTTTTGTAA

Paste this into a BLAST search page for me
AGTCGTTCCGACTACATGGACGCGAATGGACGCGATTCAGATCAGCATGAAACAACTGCCGCTGGGAGACCGTCTAGGTCACCTTCGTTGAGTTCTGGGAGACAGGAACAGCGACATCATCAAGTATCATCAAGTATGCCGGTCTGGTCACATCGCCGCCATCGAATTTGTGGGAAATTTGTGGGATTCGTTTTCGCCTGGTTGCTTGGCGAACAGCATTCGGAAGACGCCGTGCGGAATATTAATCGACGACTAAGGCCTTGCACTAATTTTAAGAAAGTACGAATTATGTTGCCCAATTTTACCTGATACAGATGGCCATTCAGAATGCGTAACGATCACTTTTGTAA

Full Affymetrix probeset data:

Annotations for 1630145_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime