FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630147_at:

>probe:Drosophila_2:1630147_at:526:141; Interrogation_Position=1007; Antisense; ACGGCGGGCATGTACTTGGGCAACC
>probe:Drosophila_2:1630147_at:35:189; Interrogation_Position=1080; Antisense; AACAGAGCAGTCGACGTCCAGAATT
>probe:Drosophila_2:1630147_at:266:363; Interrogation_Position=1100; Antisense; GAATTCGCCAGCGTGCTGCAGAGAA
>probe:Drosophila_2:1630147_at:66:375; Interrogation_Position=1127; Antisense; GAAGAGGTTTTCGAGACGCGCTACA
>probe:Drosophila_2:1630147_at:92:559; Interrogation_Position=1156; Antisense; GGAAATCGAGGACGACTCCTTCCCA
>probe:Drosophila_2:1630147_at:14:719; Interrogation_Position=1175; Antisense; TTCCCAGAGTTTGCCAGCACAAGGA
>probe:Drosophila_2:1630147_at:497:479; Interrogation_Position=1216; Antisense; GTTTGGTCTAGAGAAGGCCTCCGTG
>probe:Drosophila_2:1630147_at:728:437; Interrogation_Position=1241; Antisense; GAGGACTGCCAGACTCTGAGATACA
>probe:Drosophila_2:1630147_at:65:643; Interrogation_Position=1266; Antisense; TCTGCGAGTGCGTAGCTAAGCGAGC
>probe:Drosophila_2:1630147_at:534:591; Interrogation_Position=1323; Antisense; TGGTGAACAGGACTTCCAACCGCCG
>probe:Drosophila_2:1630147_at:62:457; Interrogation_Position=1351; Antisense; GATAGTCGGCATGGATGGCTCCGTC
>probe:Drosophila_2:1630147_at:97:499; Interrogation_Position=1373; Antisense; GTCTACCGATACCATCCAAAGTTCG
>probe:Drosophila_2:1630147_at:183:519; Interrogation_Position=1447; Antisense; GTGGGACATCATGCTCTCGGAGGAC
>probe:Drosophila_2:1630147_at:106:321; Interrogation_Position=1499; Antisense; GCCGCGGTGGCCAGTAAAACAAAGT

Paste this into a BLAST search page for me
ACGGCGGGCATGTACTTGGGCAACCAACAGAGCAGTCGACGTCCAGAATTGAATTCGCCAGCGTGCTGCAGAGAAGAAGAGGTTTTCGAGACGCGCTACAGGAAATCGAGGACGACTCCTTCCCATTCCCAGAGTTTGCCAGCACAAGGAGTTTGGTCTAGAGAAGGCCTCCGTGGAGGACTGCCAGACTCTGAGATACATCTGCGAGTGCGTAGCTAAGCGAGCTGGTGAACAGGACTTCCAACCGCCGGATAGTCGGCATGGATGGCTCCGTCGTCTACCGATACCATCCAAAGTTCGGTGGGACATCATGCTCTCGGAGGACGCCGCGGTGGCCAGTAAAACAAAGT

Full Affymetrix probeset data:

Annotations for 1630147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720