FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630149_at:

>probe:Drosophila_2:1630149_at:668:501; Interrogation_Position=178; Antisense; GTCGACATTGACAATCCCCTGATGT
>probe:Drosophila_2:1630149_at:99:617; Interrogation_Position=206; Antisense; TGCACTCGAAAACGGCCGTTGGCTA
>probe:Drosophila_2:1630149_at:699:65; Interrogation_Position=230; Antisense; ATGGAGATGCCATACGTCCCATTGC
>probe:Drosophila_2:1630149_at:710:721; Interrogation_Position=251; Antisense; TTGCCACCGATTCATCCGAGGAGGA
>probe:Drosophila_2:1630149_at:151:177; Interrogation_Position=316; Antisense; AAACGCGCTCCTTGCTTCTGGAAAA
>probe:Drosophila_2:1630149_at:372:713; Interrogation_Position=331; Antisense; TTCTGGAAAATGAGCGCTGCCGCCA
>probe:Drosophila_2:1630149_at:528:409; Interrogation_Position=398; Antisense; GACGAGCTCAAAAGCGGGCCGCCAA
>probe:Drosophila_2:1630149_at:120:513; Interrogation_Position=442; Antisense; GTGAGTCCCAAGACCACTGGCAAAA
>probe:Drosophila_2:1630149_at:33:235; Interrogation_Position=526; Antisense; AATATGGACGGAGCGGATCCCTTGG
>probe:Drosophila_2:1630149_at:249:315; Interrogation_Position=571; Antisense; GCCATGTGGCTTTCGTTTGTGAACA
>probe:Drosophila_2:1630149_at:495:159; Interrogation_Position=593; Antisense; ACAACGTAGCGGATGTGGTGCAGCA
>probe:Drosophila_2:1630149_at:25:197; Interrogation_Position=639; Antisense; AACGGCCAACTCCACGGCGTAGAAT
>probe:Drosophila_2:1630149_at:149:483; Interrogation_Position=657; Antisense; GTAGAATCACCGAGCTCCCTGACGA
>probe:Drosophila_2:1630149_at:628:609; Interrogation_Position=676; Antisense; TGACGACCACCATCGAGTGTATTTT

Paste this into a BLAST search page for me
GTCGACATTGACAATCCCCTGATGTTGCACTCGAAAACGGCCGTTGGCTAATGGAGATGCCATACGTCCCATTGCTTGCCACCGATTCATCCGAGGAGGAAAACGCGCTCCTTGCTTCTGGAAAATTCTGGAAAATGAGCGCTGCCGCCAGACGAGCTCAAAAGCGGGCCGCCAAGTGAGTCCCAAGACCACTGGCAAAAAATATGGACGGAGCGGATCCCTTGGGCCATGTGGCTTTCGTTTGTGAACAACAACGTAGCGGATGTGGTGCAGCAAACGGCCAACTCCACGGCGTAGAATGTAGAATCACCGAGCTCCCTGACGATGACGACCACCATCGAGTGTATTTT

Full Affymetrix probeset data:

Annotations for 1630149_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720