FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630151_at:

>probe:Drosophila_2:1630151_at:522:227; Interrogation_Position=443; Antisense; AATGGGCCTAGCTCTGAAACTGGAA
>probe:Drosophila_2:1630151_at:233:163; Interrogation_Position=520; Antisense; AAATCCACTATGTGAGGTGCCCGAA
>probe:Drosophila_2:1630151_at:702:533; Interrogation_Position=535; Antisense; GGTGCCCGAAACTGGATCAATTAAT
>probe:Drosophila_2:1630151_at:109:13; Interrogation_Position=554; Antisense; ATTAATGGCCACTGTGCTCAGTTGC
>probe:Drosophila_2:1630151_at:247:37; Interrogation_Position=586; Antisense; ATCTCGTCGATCATCCCGATATTAA
>probe:Drosophila_2:1630151_at:502:603; Interrogation_Position=613; Antisense; TGATTGTAATCGACTCCCTGGCTTT
>probe:Drosophila_2:1630151_at:396:285; Interrogation_Position=630; Antisense; CTGGCTTTTACTCTGCGAATGCTTG
>probe:Drosophila_2:1630151_at:85:325; Interrogation_Position=644; Antisense; GCGAATGCTTGAGGATGGCGCCCAT
>probe:Drosophila_2:1630151_at:269:7; Interrogation_Position=728; Antisense; ATTGACCTGGGTCTTCACCAATGTG
>probe:Drosophila_2:1630151_at:384:171; Interrogation_Position=776; Antisense; AAAGTTCCAAGTGGAGCCCGCCTTG
>probe:Drosophila_2:1630151_at:480:527; Interrogation_Position=802; Antisense; GGGATCTGCATTCGCACTTGATCAA
>probe:Drosophila_2:1630151_at:112:193; Interrogation_Position=825; Antisense; AACGAGCGCATCTGGTTTTCGGGCA
>probe:Drosophila_2:1630151_at:522:641; Interrogation_Position=852; Antisense; TCTGAGCTTCACCTGGGCAAGTCGT
>probe:Drosophila_2:1630151_at:196:607; Interrogation_Position=909; Antisense; TGAGGCTACATCACTTTTACTTTGT

Paste this into a BLAST search page for me
AATGGGCCTAGCTCTGAAACTGGAAAAATCCACTATGTGAGGTGCCCGAAGGTGCCCGAAACTGGATCAATTAATATTAATGGCCACTGTGCTCAGTTGCATCTCGTCGATCATCCCGATATTAATGATTGTAATCGACTCCCTGGCTTTCTGGCTTTTACTCTGCGAATGCTTGGCGAATGCTTGAGGATGGCGCCCATATTGACCTGGGTCTTCACCAATGTGAAAGTTCCAAGTGGAGCCCGCCTTGGGGATCTGCATTCGCACTTGATCAAAACGAGCGCATCTGGTTTTCGGGCATCTGAGCTTCACCTGGGCAAGTCGTTGAGGCTACATCACTTTTACTTTGT

Full Affymetrix probeset data:

Annotations for 1630151_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720