FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630152_at:

>probe:Drosophila_2:1630152_at:52:93; Interrogation_Position=187; Antisense; AGTTTCTCATCGTTTGCGGTGGCGC
>probe:Drosophila_2:1630152_at:172:563; Interrogation_Position=225; Antisense; GGAAGCCACGAATCACACTTTCAAG
>probe:Drosophila_2:1630152_at:695:205; Interrogation_Position=247; Antisense; AAGAGTTTAGCCTTCCTGGACGCGT
>probe:Drosophila_2:1630152_at:250:209; Interrogation_Position=28; Antisense; AAGCAGGCGAGCACCTTACACAGAC
>probe:Drosophila_2:1630152_at:446:39; Interrogation_Position=284; Antisense; ATCTGTTTGCGCAGACGGACGCGAA
>probe:Drosophila_2:1630152_at:555:635; Interrogation_Position=340; Antisense; TCGCAGGATGCGGACACTTCACAGT
>probe:Drosophila_2:1630152_at:452:87; Interrogation_Position=362; Antisense; AGTCGCTGCCAATTTTCGACTTTGG
>probe:Drosophila_2:1630152_at:29:13; Interrogation_Position=433; Antisense; ATTAAATGCCGCGTGGACAGTCTGC
>probe:Drosophila_2:1630152_at:369:139; Interrogation_Position=486; Antisense; ACGTGATCTGCATATCCTGACTGTA
>probe:Drosophila_2:1630152_at:375:23; Interrogation_Position=497; Antisense; ATATCCTGACTGTAGGCACTGCCAC
>probe:Drosophila_2:1630152_at:605:395; Interrogation_Position=532; Antisense; GACAAGCGCTTCCAGGTGGGTCCAT
>probe:Drosophila_2:1630152_at:241:519; Interrogation_Position=547; Antisense; GTGGGTCCATGTCGCAGGAATCCTA
>probe:Drosophila_2:1630152_at:295:267; Interrogation_Position=561; Antisense; CAGGAATCCTACATTCGCTGGCTAA
>probe:Drosophila_2:1630152_at:451:547; Interrogation_Position=84; Antisense; GGATGACTCCGGTGATGGCCCAACC

Paste this into a BLAST search page for me
AGTTTCTCATCGTTTGCGGTGGCGCGGAAGCCACGAATCACACTTTCAAGAAGAGTTTAGCCTTCCTGGACGCGTAAGCAGGCGAGCACCTTACACAGACATCTGTTTGCGCAGACGGACGCGAATCGCAGGATGCGGACACTTCACAGTAGTCGCTGCCAATTTTCGACTTTGGATTAAATGCCGCGTGGACAGTCTGCACGTGATCTGCATATCCTGACTGTAATATCCTGACTGTAGGCACTGCCACGACAAGCGCTTCCAGGTGGGTCCATGTGGGTCCATGTCGCAGGAATCCTACAGGAATCCTACATTCGCTGGCTAAGGATGACTCCGGTGATGGCCCAACC

Full Affymetrix probeset data:

Annotations for 1630152_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720