FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630154_at:

>probe:Drosophila_2:1630154_at:369:199; Interrogation_Position=518; Antisense; AACCCACCGTTCGTGAGCTTGAGCG
>probe:Drosophila_2:1630154_at:338:575; Interrogation_Position=542; Antisense; GGCGCTGCTTCATAGAGAGCCTGTA
>probe:Drosophila_2:1630154_at:511:243; Interrogation_Position=568; Antisense; CAATTGTTTAATCTGGGTTCTCCCG
>probe:Drosophila_2:1630154_at:349:547; Interrogation_Position=636; Antisense; GGATGCGACGTTTAAGCTTTGTTTT
>probe:Drosophila_2:1630154_at:713:601; Interrogation_Position=667; Antisense; TGTTTGGCCTTCCAACAGGGCAATT
>probe:Drosophila_2:1630154_at:12:679; Interrogation_Position=696; Antisense; TAGAGTGCTCATGGGTGTGCCACAA
>probe:Drosophila_2:1630154_at:663:597; Interrogation_Position=711; Antisense; TGTGCCACAATTGCCGCATATTCTG
>probe:Drosophila_2:1630154_at:240:487; Interrogation_Position=742; Antisense; GTAGCTGCCGCCAAGTTGCAGGTGA
>probe:Drosophila_2:1630154_at:689:615; Interrogation_Position=782; Antisense; TGCAGATTTTCACGCATGCCTACAA
>probe:Drosophila_2:1630154_at:409:239; Interrogation_Position=807; Antisense; CAACAAACAGCTTACGGTGCCGGTT
>probe:Drosophila_2:1630154_at:719:539; Interrogation_Position=828; Antisense; GGTTCCTTACTTGTTGCGTTTACTG
>probe:Drosophila_2:1630154_at:149:299; Interrogation_Position=843; Antisense; GCGTTTACTGTTGTTCGATGGGCCA
>probe:Drosophila_2:1630154_at:47:543; Interrogation_Position=871; Antisense; GGATTGCAGGACCAATGTCGGCATT
>probe:Drosophila_2:1630154_at:722:97; Interrogation_Position=963; Antisense; AGAGGTATTTACACCCCAACACGAG

Paste this into a BLAST search page for me
AACCCACCGTTCGTGAGCTTGAGCGGGCGCTGCTTCATAGAGAGCCTGTACAATTGTTTAATCTGGGTTCTCCCGGGATGCGACGTTTAAGCTTTGTTTTTGTTTGGCCTTCCAACAGGGCAATTTAGAGTGCTCATGGGTGTGCCACAATGTGCCACAATTGCCGCATATTCTGGTAGCTGCCGCCAAGTTGCAGGTGATGCAGATTTTCACGCATGCCTACAACAACAAACAGCTTACGGTGCCGGTTGGTTCCTTACTTGTTGCGTTTACTGGCGTTTACTGTTGTTCGATGGGCCAGGATTGCAGGACCAATGTCGGCATTAGAGGTATTTACACCCCAACACGAG

Full Affymetrix probeset data:

Annotations for 1630154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720