FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630155_at:

>probe:Drosophila_2:1630155_at:320:95; Interrogation_Position=317; Antisense; AGATCAAGTTGGTGAGTAGCCGGAC
>probe:Drosophila_2:1630155_at:117:251; Interrogation_Position=321; Antisense; CAAGTTGGTGAGTAGCCGGACGTTT
>probe:Drosophila_2:1630155_at:16:513; Interrogation_Position=328; Antisense; GTGAGTAGCCGGACGTTTGTCACAA
>probe:Drosophila_2:1630155_at:234:91; Interrogation_Position=331; Antisense; AGTAGCCGGACGTTTGTCACAACCA
>probe:Drosophila_2:1630155_at:132:123; Interrogation_Position=334; Antisense; AGCCGGACGTTTGTCACAACCAGAA
>probe:Drosophila_2:1630155_at:252:555; Interrogation_Position=338; Antisense; GGACGTTTGTCACAACCAGAACTAA
>probe:Drosophila_2:1630155_at:70:477; Interrogation_Position=342; Antisense; GTTTGTCACAACCAGAACTAAAAGG
>probe:Drosophila_2:1630155_at:321:255; Interrogation_Position=348; Antisense; CACAACCAGAACTAAAAGGTCACTA
>probe:Drosophila_2:1630155_at:450:79; Interrogation_Position=364; Antisense; AGGTCACTAATACTTCTCATTCGCA
>probe:Drosophila_2:1630155_at:58:539; Interrogation_Position=365; Antisense; GGTCACTAATACTTCTCATTCGCAC
>probe:Drosophila_2:1630155_at:503:655; Interrogation_Position=371; Antisense; TAATACTTCTCATTCGCACCCAGAT
>probe:Drosophila_2:1630155_at:47:29; Interrogation_Position=373; Antisense; ATACTTCTCATTCGCACCCAGATGG
>probe:Drosophila_2:1630155_at:24:711; Interrogation_Position=377; Antisense; TTCTCATTCGCACCCAGATGGACGC
>probe:Drosophila_2:1630155_at:134:719; Interrogation_Position=383; Antisense; TTCGCACCCAGATGGACGCCGACAA

Paste this into a BLAST search page for me
AGATCAAGTTGGTGAGTAGCCGGACCAAGTTGGTGAGTAGCCGGACGTTTGTGAGTAGCCGGACGTTTGTCACAAAGTAGCCGGACGTTTGTCACAACCAAGCCGGACGTTTGTCACAACCAGAAGGACGTTTGTCACAACCAGAACTAAGTTTGTCACAACCAGAACTAAAAGGCACAACCAGAACTAAAAGGTCACTAAGGTCACTAATACTTCTCATTCGCAGGTCACTAATACTTCTCATTCGCACTAATACTTCTCATTCGCACCCAGATATACTTCTCATTCGCACCCAGATGGTTCTCATTCGCACCCAGATGGACGCTTCGCACCCAGATGGACGCCGACAA

Full Affymetrix probeset data:

Annotations for 1630155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720