FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630156_at:

>probe:Drosophila_2:1630156_at:252:209; Interrogation_Position=116; Antisense; AAGCACGAGGCGACGCTGAAGCTGC
>probe:Drosophila_2:1630156_at:76:641; Interrogation_Position=13; Antisense; TCTGTATACGTTCACACCTGCCAGC
>probe:Drosophila_2:1630156_at:624:699; Interrogation_Position=204; Antisense; TTTTCGATGCGGGATTAGCCCGTTT
>probe:Drosophila_2:1630156_at:390:13; Interrogation_Position=217; Antisense; ATTAGCCCGTTTCCAGGCGATGCGA
>probe:Drosophila_2:1630156_at:294:479; Interrogation_Position=225; Antisense; GTTTCCAGGCGATGCGAGTCTCCAA
>probe:Drosophila_2:1630156_at:61:431; Interrogation_Position=240; Antisense; GAGTCTCCAACTACGAACACTTCAA
>probe:Drosophila_2:1630156_at:153:155; Interrogation_Position=26; Antisense; ACACCTGCCAGCTGTTGCTAAAAAT
>probe:Drosophila_2:1630156_at:511:625; Interrogation_Position=316; Antisense; TGCCCTCTACGCCTGGGCTTTGAAG
>probe:Drosophila_2:1630156_at:417:217; Interrogation_Position=365; Antisense; AAGTACAGGACTGGCCAGGTGGCCT
>probe:Drosophila_2:1630156_at:63:81; Interrogation_Position=381; Antisense; AGGTGGCCTACAAGGACCGCCAGTT
>probe:Drosophila_2:1630156_at:193:659; Interrogation_Position=389; Antisense; TACAAGGACCGCCAGTTCAAGTTCA
>probe:Drosophila_2:1630156_at:564:473; Interrogation_Position=403; Antisense; GTTCAAGTTCATCTAAGCCATACAT
>probe:Drosophila_2:1630156_at:263:279; Interrogation_Position=415; Antisense; CTAAGCCATACATTCAGCCAATTGA
>probe:Drosophila_2:1630156_at:481:127; Interrogation_Position=430; Antisense; AGCCAATTGATCTTCGATTCGTATA

Paste this into a BLAST search page for me
AAGCACGAGGCGACGCTGAAGCTGCTCTGTATACGTTCACACCTGCCAGCTTTTCGATGCGGGATTAGCCCGTTTATTAGCCCGTTTCCAGGCGATGCGAGTTTCCAGGCGATGCGAGTCTCCAAGAGTCTCCAACTACGAACACTTCAAACACCTGCCAGCTGTTGCTAAAAATTGCCCTCTACGCCTGGGCTTTGAAGAAGTACAGGACTGGCCAGGTGGCCTAGGTGGCCTACAAGGACCGCCAGTTTACAAGGACCGCCAGTTCAAGTTCAGTTCAAGTTCATCTAAGCCATACATCTAAGCCATACATTCAGCCAATTGAAGCCAATTGATCTTCGATTCGTATA

Full Affymetrix probeset data:

Annotations for 1630156_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720