FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630158_at:

>probe:Drosophila_2:1630158_at:622:407; Interrogation_Position=355; Antisense; GACGGTTGTGTCTACTTTGGAAAAT
>probe:Drosophila_2:1630158_at:518:165; Interrogation_Position=387; Antisense; AAATCGACGGCACGGTTTGGGCATC
>probe:Drosophila_2:1630158_at:15:693; Interrogation_Position=402; Antisense; TTTGGGCATCCAGTGGTACAACGAT
>probe:Drosophila_2:1630158_at:541:559; Interrogation_Position=450; Antisense; GGAAACAGATTTCCGGCATGGACTT
>probe:Drosophila_2:1630158_at:385:371; Interrogation_Position=508; Antisense; GAAGGACACTTTGCACGCGGATATA
>probe:Drosophila_2:1630158_at:250:477; Interrogation_Position=547; Antisense; GTTTTCTATCATATGCACACGGGAC
>probe:Drosophila_2:1630158_at:665:471; Interrogation_Position=663; Antisense; GTATCCGATTCCACGAAACTATCTT
>probe:Drosophila_2:1630158_at:57:111; Interrogation_Position=739; Antisense; AGCAATAAGCCCCATCGTAGATTCA
>probe:Drosophila_2:1630158_at:483:153; Interrogation_Position=767; Antisense; ACAGGGTCAGTCTTGCCTTTATTCA
>probe:Drosophila_2:1630158_at:493:699; Interrogation_Position=784; Antisense; TTTATTCACCATCACCGACAGTACG
>probe:Drosophila_2:1630158_at:602:399; Interrogation_Position=800; Antisense; GACAGTACGCCTCCTGCGAAGAGCG
>probe:Drosophila_2:1630158_at:526:341; Interrogation_Position=824; Antisense; GCTTCGCTTCACCAACAATTGTAGA
>probe:Drosophila_2:1630158_at:223:281; Interrogation_Position=850; Antisense; CTCTACCCCAGAGCTGAGTTTGGAT
>probe:Drosophila_2:1630158_at:721:477; Interrogation_Position=867; Antisense; GTTTGGATGCACTTGCGACTGCGAA

Paste this into a BLAST search page for me
GACGGTTGTGTCTACTTTGGAAAATAAATCGACGGCACGGTTTGGGCATCTTTGGGCATCCAGTGGTACAACGATGGAAACAGATTTCCGGCATGGACTTGAAGGACACTTTGCACGCGGATATAGTTTTCTATCATATGCACACGGGACGTATCCGATTCCACGAAACTATCTTAGCAATAAGCCCCATCGTAGATTCAACAGGGTCAGTCTTGCCTTTATTCATTTATTCACCATCACCGACAGTACGGACAGTACGCCTCCTGCGAAGAGCGGCTTCGCTTCACCAACAATTGTAGACTCTACCCCAGAGCTGAGTTTGGATGTTTGGATGCACTTGCGACTGCGAA

Full Affymetrix probeset data:

Annotations for 1630158_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720