FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630159_at:

>probe:Drosophila_2:1630159_at:187:709; Interrogation_Position=529; Antisense; TTAATCCTCTAGCTTCAGCTGGCGG
>probe:Drosophila_2:1630159_at:136:121; Interrogation_Position=545; Antisense; AGCTGGCGGAAGTGTCTGTTTCATT
>probe:Drosophila_2:1630159_at:572:641; Interrogation_Position=559; Antisense; TCTGTTTCATTAACGCGATGGCGGA
>probe:Drosophila_2:1630159_at:158:529; Interrogation_Position=594; Antisense; GGGATGGCCCAATCCATGCACAATG
>probe:Drosophila_2:1630159_at:179:233; Interrogation_Position=615; Antisense; AATGCATCCCTAATCCTGGTGCAGA
>probe:Drosophila_2:1630159_at:657:101; Interrogation_Position=646; Antisense; AGACCGCCGAGGATCAAGTGGTGCA
>probe:Drosophila_2:1630159_at:235:619; Interrogation_Position=667; Antisense; TGCAGGCTCAGCTGTGCAGTGCCAT
>probe:Drosophila_2:1630159_at:94:519; Interrogation_Position=693; Antisense; GTGGTGCAGCACATCGGCGACTATC
>probe:Drosophila_2:1630159_at:149:421; Interrogation_Position=726; Antisense; GAGCAGGATCAGTGCCGGCAATCAT
>probe:Drosophila_2:1630159_at:256:561; Interrogation_Position=742; Antisense; GGCAATCATAGTGGACCGACCCTTC
>probe:Drosophila_2:1630159_at:78:585; Interrogation_Position=812; Antisense; TGGCAAATTTATGCACCCGCAAGAT
>probe:Drosophila_2:1630159_at:694:257; Interrogation_Position=857; Antisense; CACATCCTGTTCACTTATTGCTTAT
>probe:Drosophila_2:1630159_at:21:697; Interrogation_Position=915; Antisense; TTTACAGCTGCTGCAGTCGATCTGG
>probe:Drosophila_2:1630159_at:172:501; Interrogation_Position=930; Antisense; GTCGATCTGGTACAGCTATCAGCAT

Paste this into a BLAST search page for me
TTAATCCTCTAGCTTCAGCTGGCGGAGCTGGCGGAAGTGTCTGTTTCATTTCTGTTTCATTAACGCGATGGCGGAGGGATGGCCCAATCCATGCACAATGAATGCATCCCTAATCCTGGTGCAGAAGACCGCCGAGGATCAAGTGGTGCATGCAGGCTCAGCTGTGCAGTGCCATGTGGTGCAGCACATCGGCGACTATCGAGCAGGATCAGTGCCGGCAATCATGGCAATCATAGTGGACCGACCCTTCTGGCAAATTTATGCACCCGCAAGATCACATCCTGTTCACTTATTGCTTATTTTACAGCTGCTGCAGTCGATCTGGGTCGATCTGGTACAGCTATCAGCAT

Full Affymetrix probeset data:

Annotations for 1630159_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720