FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630162_at:

>probe:Drosophila_2:1630162_at:643:361; Interrogation_Position=139; Antisense; GCAATGGACGCGAAAGCCACTGCCA
>probe:Drosophila_2:1630162_at:384:277; Interrogation_Position=168; Antisense; CTTTAGTTTGAGCATCGTGGGCCAA
>probe:Drosophila_2:1630162_at:251:161; Interrogation_Position=224; Antisense; ACAAGGAGTTCGTCTTCCTGCGCTA
>probe:Drosophila_2:1630162_at:613:337; Interrogation_Position=245; Antisense; GCTACGAAATGGTCGCTGGTCCCGA
>probe:Drosophila_2:1630162_at:707:519; Interrogation_Position=327; Antisense; GGGCCATTTCAACGAACCGATTGTC
>probe:Drosophila_2:1630162_at:562:465; Interrogation_Position=345; Antisense; GATTGTCTTCAATATGCCCATCGAG
>probe:Drosophila_2:1630162_at:652:127; Interrogation_Position=373; Antisense; ACCTACAAGAGCACCAGTCCATATG
>probe:Drosophila_2:1630162_at:445:79; Interrogation_Position=445; Antisense; AGGGAGACACTACTCGGTTACGCTC
>probe:Drosophila_2:1630162_at:189:87; Interrogation_Position=548; Antisense; AGTGCCCCAACATGATGGCGGACAT
>probe:Drosophila_2:1630162_at:263:69; Interrogation_Position=562; Antisense; ATGGCGGACATCACCAGTTGGCTGC
>probe:Drosophila_2:1630162_at:564:333; Interrogation_Position=603; Antisense; GCTGAAGGACCCCAAAGTGCTGCTG
>probe:Drosophila_2:1630162_at:32:681; Interrogation_Position=654; Antisense; TATGGAGTCGTACGGCAGCCTACAG
>probe:Drosophila_2:1630162_at:530:91; Interrogation_Position=677; Antisense; AGTTTCAGCTGTCCTCCGTGATGAG
>probe:Drosophila_2:1630162_at:264:361; Interrogation_Position=710; Antisense; GCAAGCTGGGCTACCATTGGCACTC

Paste this into a BLAST search page for me
GCAATGGACGCGAAAGCCACTGCCACTTTAGTTTGAGCATCGTGGGCCAAACAAGGAGTTCGTCTTCCTGCGCTAGCTACGAAATGGTCGCTGGTCCCGAGGGCCATTTCAACGAACCGATTGTCGATTGTCTTCAATATGCCCATCGAGACCTACAAGAGCACCAGTCCATATGAGGGAGACACTACTCGGTTACGCTCAGTGCCCCAACATGATGGCGGACATATGGCGGACATCACCAGTTGGCTGCGCTGAAGGACCCCAAAGTGCTGCTGTATGGAGTCGTACGGCAGCCTACAGAGTTTCAGCTGTCCTCCGTGATGAGGCAAGCTGGGCTACCATTGGCACTC

Full Affymetrix probeset data:

Annotations for 1630162_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720