Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630163_at:

>probe:Drosophila_2:1630163_at:418:571; Interrogation_Position=1377; Antisense; GGCTCCAAATTACCGCCATCGAAAG
>probe:Drosophila_2:1630163_at:299:393; Interrogation_Position=1397; Antisense; GAAAGACGCGCCTGTCAGTCAGGAA
>probe:Drosophila_2:1630163_at:348:227; Interrogation_Position=1470; Antisense; AAGGCTTCTTGCGATAAGTATCTCC
>probe:Drosophila_2:1630163_at:14:363; Interrogation_Position=1519; Antisense; GCAATATTACCTGCAACGCGGGTTA
>probe:Drosophila_2:1630163_at:134:331; Interrogation_Position=1536; Antisense; GCGGGTTATATCATGCAGGGCTCAC
>probe:Drosophila_2:1630163_at:673:349; Interrogation_Position=1550; Antisense; GCAGGGCTCACAATTTGCGGTTTGT
>probe:Drosophila_2:1630163_at:649:585; Interrogation_Position=1574; Antisense; TGGACACACCGGACTTTGGTCTAGT
>probe:Drosophila_2:1630163_at:164:379; Interrogation_Position=1602; Antisense; GAAGCCAAGTGCGTGGAATCCCTCG
>probe:Drosophila_2:1630163_at:256:367; Interrogation_Position=1617; Antisense; GAATCCCTCGCATTGAGTTGTCCAG
>probe:Drosophila_2:1630163_at:347:409; Interrogation_Position=1663; Antisense; GACGTTTCTATCCTGCAAGCTGCAA
>probe:Drosophila_2:1630163_at:19:233; Interrogation_Position=1689; Antisense; AATGAACCATCCAAATCACTCGCGA
>probe:Drosophila_2:1630163_at:494:63; Interrogation_Position=1727; Antisense; ATGTGATCGAGGCTATTTGCCCAGA
>probe:Drosophila_2:1630163_at:149:625; Interrogation_Position=1744; Antisense; TGCCCAGAATGGACACACAGCTCAT
>probe:Drosophila_2:1630163_at:111:541; Interrogation_Position=1886; Antisense; GGATTCCACAAAGCCGTTAATTTAT

Paste this into a BLAST search page for me
GGCTCCAAATTACCGCCATCGAAAGGAAAGACGCGCCTGTCAGTCAGGAAAAGGCTTCTTGCGATAAGTATCTCCGCAATATTACCTGCAACGCGGGTTAGCGGGTTATATCATGCAGGGCTCACGCAGGGCTCACAATTTGCGGTTTGTTGGACACACCGGACTTTGGTCTAGTGAAGCCAAGTGCGTGGAATCCCTCGGAATCCCTCGCATTGAGTTGTCCAGGACGTTTCTATCCTGCAAGCTGCAAAATGAACCATCCAAATCACTCGCGAATGTGATCGAGGCTATTTGCCCAGATGCCCAGAATGGACACACAGCTCATGGATTCCACAAAGCCGTTAATTTAT

Full Affymetrix probeset data:

Annotations for 1630163_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime