FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630167_at:

>probe:Drosophila_2:1630167_at:278:103; Interrogation_Position=162; Antisense; AGAGCTGGTTTATTCCCCACAACTG
>probe:Drosophila_2:1630167_at:718:471; Interrogation_Position=202; Antisense; GTAGAAGCCTGTCGCAAATCTCAGT
>probe:Drosophila_2:1630167_at:261:239; Interrogation_Position=218; Antisense; AATCTCAGTTCTGTATTCGCCAGCA
>probe:Drosophila_2:1630167_at:234:521; Interrogation_Position=271; Antisense; GTGGCAGTGCGAATCTCCGGAGAAT
>probe:Drosophila_2:1630167_at:713:313; Interrogation_Position=441; Antisense; GCCATCTTCAAGCAGTTCGTGCTGA
>probe:Drosophila_2:1630167_at:668:711; Interrogation_Position=483; Antisense; TTCAGCTTCATGACGGGCGTGGCAT
>probe:Drosophila_2:1630167_at:114:109; Interrogation_Position=517; Antisense; AGAAGATCAACCACCATCCCGAGTG
>probe:Drosophila_2:1630167_at:86:47; Interrogation_Position=532; Antisense; ATCCCGAGTGGTTCAACTGCTACAA
>probe:Drosophila_2:1630167_at:320:137; Interrogation_Position=583; Antisense; ACGACGTGGGCGGTCTCAGTTCGCA
>probe:Drosophila_2:1630167_at:275:647; Interrogation_Position=598; Antisense; TCAGTTCGCAGGACATTCGCATGGC
>probe:Drosophila_2:1630167_at:631:9; Interrogation_Position=612; Antisense; ATTCGCATGGCCACGCACTTGGAGA
>probe:Drosophila_2:1630167_at:524:551; Interrogation_Position=632; Antisense; GGAGACCACGGCCAATTTGTTGAAA
>probe:Drosophila_2:1630167_at:355:23; Interrogation_Position=684; Antisense; ATATCTATAATCTTCGGTGTCCAAT
>probe:Drosophila_2:1630167_at:272:533; Interrogation_Position=699; Antisense; GGTGTCCAATAAATACTCAGCTTAG

Paste this into a BLAST search page for me
AGAGCTGGTTTATTCCCCACAACTGGTAGAAGCCTGTCGCAAATCTCAGTAATCTCAGTTCTGTATTCGCCAGCAGTGGCAGTGCGAATCTCCGGAGAATGCCATCTTCAAGCAGTTCGTGCTGATTCAGCTTCATGACGGGCGTGGCATAGAAGATCAACCACCATCCCGAGTGATCCCGAGTGGTTCAACTGCTACAAACGACGTGGGCGGTCTCAGTTCGCATCAGTTCGCAGGACATTCGCATGGCATTCGCATGGCCACGCACTTGGAGAGGAGACCACGGCCAATTTGTTGAAAATATCTATAATCTTCGGTGTCCAATGGTGTCCAATAAATACTCAGCTTAG

Full Affymetrix probeset data:

Annotations for 1630167_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720