Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630168_at:

>probe:Drosophila_2:1630168_at:590:531; Interrogation_Position=362; Antisense; GGGTGACCATAATTCGCGCCGGTTC
>probe:Drosophila_2:1630168_at:74:319; Interrogation_Position=379; Antisense; GCCGGTTCCTACGATACGAGCAAAC
>probe:Drosophila_2:1630168_at:697:717; Interrogation_Position=409; Antisense; TTCCAGGACATCATTCGCGTGGGTT
>probe:Drosophila_2:1630168_at:290:59; Interrogation_Position=454; Antisense; ATGTTCGAGGACGACAACGCCACGG
>probe:Drosophila_2:1630168_at:234:351; Interrogation_Position=546; Antisense; GCAGTTGCTCAGTAAGTTCTCCACA
>probe:Drosophila_2:1630168_at:98:31; Interrogation_Position=607; Antisense; ATACACTTCATCAATGTTCCTGCGG
>probe:Drosophila_2:1630168_at:662:469; Interrogation_Position=622; Antisense; GTTCCTGCGGCCTTTGAAACTGGAT
>probe:Drosophila_2:1630168_at:386:391; Interrogation_Position=637; Antisense; GAAACTGGATTCAATTCCCTGCGCT
>probe:Drosophila_2:1630168_at:689:537; Interrogation_Position=661; Antisense; TCCTTTTTCCCTGCCAAAATCAAGA
>probe:Drosophila_2:1630168_at:51:253; Interrogation_Position=681; Antisense; CAAGAGTCGGATCTCGGTGAGCTCC
>probe:Drosophila_2:1630168_at:266:449; Interrogation_Position=706; Antisense; GATCCGGCGGCCATATACGAGCTAG
>probe:Drosophila_2:1630168_at:143:285; Interrogation_Position=778; Antisense; CTGCAGGATATAAGCCACACCATGG
>probe:Drosophila_2:1630168_at:397:395; Interrogation_Position=807; Antisense; GAAATTGTCCAGCTATGGGCCCTAC
>probe:Drosophila_2:1630168_at:192:217; Interrogation_Position=865; Antisense; AAGTTGCGCGAGTTTGGAGACCATA

Paste this into a BLAST search page for me
GGGTGACCATAATTCGCGCCGGTTCGCCGGTTCCTACGATACGAGCAAACTTCCAGGACATCATTCGCGTGGGTTATGTTCGAGGACGACAACGCCACGGGCAGTTGCTCAGTAAGTTCTCCACAATACACTTCATCAATGTTCCTGCGGGTTCCTGCGGCCTTTGAAACTGGATGAAACTGGATTCAATTCCCTGCGCTTCCTTTTTCCCTGCCAAAATCAAGACAAGAGTCGGATCTCGGTGAGCTCCGATCCGGCGGCCATATACGAGCTAGCTGCAGGATATAAGCCACACCATGGGAAATTGTCCAGCTATGGGCCCTACAAGTTGCGCGAGTTTGGAGACCATA

Full Affymetrix probeset data:

Annotations for 1630168_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime