FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630170_at:

>probe:Drosophila_2:1630170_at:130:727; Interrogation_Position=1107; Antisense; TTGTCTGACTATCCTCTATCACTTG
>probe:Drosophila_2:1630170_at:561:1; Interrogation_Position=1189; Antisense; ACCACCAAGGACTCGTTGACGGATC
>probe:Drosophila_2:1630170_at:286:179; Interrogation_Position=1224; Antisense; AAACATGCCTTATCTGAGAGCCTGC
>probe:Drosophila_2:1630170_at:488:33; Interrogation_Position=1249; Antisense; ATCAAGGAGGGTCTGCGCATCACAT
>probe:Drosophila_2:1630170_at:652:345; Interrogation_Position=1265; Antisense; GCATCACATCTATTACGCCGGGAAA
>probe:Drosophila_2:1630170_at:82:545; Interrogation_Position=1285; Antisense; GGAAATTTTCGCATAACACCCAAGG
>probe:Drosophila_2:1630170_at:469:77; Interrogation_Position=1307; Antisense; AGGATCTAGTGCTATCGGGCTATCA
>probe:Drosophila_2:1630170_at:341:649; Interrogation_Position=1398; Antisense; TCAGAGCTCTGAGTTCATACCGGAA
>probe:Drosophila_2:1630170_at:253:561; Interrogation_Position=1419; Antisense; GGAACGCTGGCTTAAGTCCGACTTA
>probe:Drosophila_2:1630170_at:254:403; Interrogation_Position=1438; Antisense; GACTTAGCTCCGGATATCCAGGCTT
>probe:Drosophila_2:1630170_at:551:729; Interrogation_Position=1511; Antisense; TTGGACCTCGAACCTGTATTGGCAA
>probe:Drosophila_2:1630170_at:21:593; Interrogation_Position=1568; Antisense; TGGTGCGACTCTTGCGAAGCTACAA
>probe:Drosophila_2:1630170_at:47:337; Interrogation_Position=1602; Antisense; GCTGCCCGAAACTCCGATTGAATAT
>probe:Drosophila_2:1630170_at:636:131; Interrogation_Position=1647; Antisense; ACCCTGCGGTGACATTCGCTTTAAA

Paste this into a BLAST search page for me
TTGTCTGACTATCCTCTATCACTTGACCACCAAGGACTCGTTGACGGATCAAACATGCCTTATCTGAGAGCCTGCATCAAGGAGGGTCTGCGCATCACATGCATCACATCTATTACGCCGGGAAAGGAAATTTTCGCATAACACCCAAGGAGGATCTAGTGCTATCGGGCTATCATCAGAGCTCTGAGTTCATACCGGAAGGAACGCTGGCTTAAGTCCGACTTAGACTTAGCTCCGGATATCCAGGCTTTTGGACCTCGAACCTGTATTGGCAATGGTGCGACTCTTGCGAAGCTACAAGCTGCCCGAAACTCCGATTGAATATACCCTGCGGTGACATTCGCTTTAAA

Full Affymetrix probeset data:

Annotations for 1630170_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720