FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630171_at:

>probe:Drosophila_2:1630171_at:338:563; Interrogation_Position=1026; Antisense; GGAACCGGATTACTCGCAAACGCAG
>probe:Drosophila_2:1630171_at:527:65; Interrogation_Position=1061; Antisense; ATGGTCCCTCGAATGTGCGGATTTC
>probe:Drosophila_2:1630171_at:228:411; Interrogation_Position=1178; Antisense; TGCTGGAACCCGTGGGCTTTGGCCA
>probe:Drosophila_2:1630171_at:401:583; Interrogation_Position=1290; Antisense; TGGCTCCGGATTGCTCGATCAGTTA
>probe:Drosophila_2:1630171_at:721:619; Interrogation_Position=1304; Antisense; TCGATCAGTTAGCTCGGGACTACGC
>probe:Drosophila_2:1630171_at:1:131; Interrogation_Position=1366; Antisense; ACCTTCGGCTACTACTGAGCTGGAG
>probe:Drosophila_2:1630171_at:375:581; Interrogation_Position=1393; Antisense; TGGCAGGCGGTTGCAGTGCCCATCA
>probe:Drosophila_2:1630171_at:666:621; Interrogation_Position=1409; Antisense; TGCCCATCATCCTGAATAACCCAGA
>probe:Drosophila_2:1630171_at:331:31; Interrogation_Position=1424; Antisense; ATAACCCAGAGATTCCTTGCTTCTA
>probe:Drosophila_2:1630171_at:354:95; Interrogation_Position=1433; Antisense; AGATTCCTTGCTTCTAGGTCCTAAT
>probe:Drosophila_2:1630171_at:618:77; Interrogation_Position=1448; Antisense; AGGTCCTAATCGCACAGGTGTACCC
>probe:Drosophila_2:1630171_at:404:601; Interrogation_Position=1466; Antisense; TGTACCCTGTCCTCAGATTTTCTAA
>probe:Drosophila_2:1630171_at:87:213; Interrogation_Position=954; Antisense; AAGACTCCAGGTTCCTGGTGCTCAG
>probe:Drosophila_2:1630171_at:98:591; Interrogation_Position=969; Antisense; TGGTGCTCAGCGAACCACCGACGTA

Paste this into a BLAST search page for me
GGAACCGGATTACTCGCAAACGCAGATGGTCCCTCGAATGTGCGGATTTCTGCTGGAACCCGTGGGCTTTGGCCATGGCTCCGGATTGCTCGATCAGTTATCGATCAGTTAGCTCGGGACTACGCACCTTCGGCTACTACTGAGCTGGAGTGGCAGGCGGTTGCAGTGCCCATCATGCCCATCATCCTGAATAACCCAGAATAACCCAGAGATTCCTTGCTTCTAAGATTCCTTGCTTCTAGGTCCTAATAGGTCCTAATCGCACAGGTGTACCCTGTACCCTGTCCTCAGATTTTCTAAAAGACTCCAGGTTCCTGGTGCTCAGTGGTGCTCAGCGAACCACCGACGTA

Full Affymetrix probeset data:

Annotations for 1630171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720