FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630176_at:

>probe:Drosophila_2:1630176_at:626:435; Interrogation_Position=1330; Antisense; GAGGCATCAGAGGAGCCGATAATAT
>probe:Drosophila_2:1630176_at:210:251; Interrogation_Position=1374; Antisense; CAAGATATCGAAGGCCATGGCCGCA
>probe:Drosophila_2:1630176_at:494:259; Interrogation_Position=1397; Antisense; CACGGTTCGCTGAACCCGAGGGATA
>probe:Drosophila_2:1630176_at:614:377; Interrogation_Position=1408; Antisense; GAACCCGAGGGATACGCAGAATGCT
>probe:Drosophila_2:1630176_at:22:137; Interrogation_Position=1421; Antisense; ACGCAGAATGCTATCCCGGGCTGGA
>probe:Drosophila_2:1630176_at:370:613; Interrogation_Position=1451; Antisense; TGAACGACGCCATCGACGACTCGGA
>probe:Drosophila_2:1630176_at:22:147; Interrogation_Position=1469; Antisense; ACTCGGACGATGAGGTGGATTACAC
>probe:Drosophila_2:1630176_at:170:3; Interrogation_Position=1525; Antisense; ATTGGACGCTGGGACTTTGACACGC
>probe:Drosophila_2:1630176_at:246:431; Interrogation_Position=1555; Antisense; GAGTACTCCGACTACATGAGCACGA
>probe:Drosophila_2:1630176_at:131:57; Interrogation_Position=1570; Antisense; ATGAGCACGAAGGAGGCGCTGCCCA
>probe:Drosophila_2:1630176_at:514:651; Interrogation_Position=1616; Antisense; TCAAGATGCAGGACGGTCGCAAGAC
>probe:Drosophila_2:1630176_at:641:443; Interrogation_Position=1762; Antisense; GATGAACCCGATTACAAATCCGCAA
>probe:Drosophila_2:1630176_at:10:485; Interrogation_Position=1853; Antisense; GTATGCTCGTACTTGTATTAATCTT
>probe:Drosophila_2:1630176_at:466:481; Interrogation_Position=1867; Antisense; GTATTAATCTTACATGCTCTCAAAT

Paste this into a BLAST search page for me
GAGGCATCAGAGGAGCCGATAATATCAAGATATCGAAGGCCATGGCCGCACACGGTTCGCTGAACCCGAGGGATAGAACCCGAGGGATACGCAGAATGCTACGCAGAATGCTATCCCGGGCTGGATGAACGACGCCATCGACGACTCGGAACTCGGACGATGAGGTGGATTACACATTGGACGCTGGGACTTTGACACGCGAGTACTCCGACTACATGAGCACGAATGAGCACGAAGGAGGCGCTGCCCATCAAGATGCAGGACGGTCGCAAGACGATGAACCCGATTACAAATCCGCAAGTATGCTCGTACTTGTATTAATCTTGTATTAATCTTACATGCTCTCAAAT

Full Affymetrix probeset data:

Annotations for 1630176_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720