FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630177_at:

>probe:Drosophila_2:1630177_at:581:627; Interrogation_Position=2836; Antisense; TGCCACATATCCTGCAGCTGGTGGA
>probe:Drosophila_2:1630177_at:333:513; Interrogation_Position=2877; Antisense; GTGATGGACAAGCAGTACGCCGCCA
>probe:Drosophila_2:1630177_at:74:135; Interrogation_Position=2925; Antisense; ACGCCTCGCTTCTATGATTCATTGG
>probe:Drosophila_2:1630177_at:71:537; Interrogation_Position=2948; Antisense; GGTCATTCATGACGAACACGAGCTG
>probe:Drosophila_2:1630177_at:127:295; Interrogation_Position=3014; Antisense; CGAGGAATTTCACACCAAGGGCTAC
>probe:Drosophila_2:1630177_at:169:133; Interrogation_Position=3061; Antisense; ACCGCCACAGGCAGTTGGTGCTCAA
>probe:Drosophila_2:1630177_at:602:533; Interrogation_Position=3077; Antisense; GGTGCTCAAAGATCCCGTTTACAAG
>probe:Drosophila_2:1630177_at:125:133; Interrogation_Position=3111; Antisense; ACCGAGTATCTCAAGTGGCAGCTGC
>probe:Drosophila_2:1630177_at:713:467; Interrogation_Position=3140; Antisense; GTTGCAGGCACAGCTGGGATCCCAG
>probe:Drosophila_2:1630177_at:126:547; Interrogation_Position=3156; Antisense; GGATCCCAGCGATATGAGCAGGTAA
>probe:Drosophila_2:1630177_at:561:79; Interrogation_Position=3175; Antisense; AGGTAATGTGCTCCGTGGTTCCCGA
>probe:Drosophila_2:1630177_at:430:25; Interrogation_Position=3225; Antisense; ATAGAGCAGACTGTGCCCAAGGCCT
>probe:Drosophila_2:1630177_at:378:153; Interrogation_Position=3295; Antisense; ACAGGACGCTCTCCGAACAGGTGGA
>probe:Drosophila_2:1630177_at:450:463; Interrogation_Position=3328; Antisense; GATTCCGGACTGCTGTGCTTTAAAA

Paste this into a BLAST search page for me
TGCCACATATCCTGCAGCTGGTGGAGTGATGGACAAGCAGTACGCCGCCAACGCCTCGCTTCTATGATTCATTGGGGTCATTCATGACGAACACGAGCTGCGAGGAATTTCACACCAAGGGCTACACCGCCACAGGCAGTTGGTGCTCAAGGTGCTCAAAGATCCCGTTTACAAGACCGAGTATCTCAAGTGGCAGCTGCGTTGCAGGCACAGCTGGGATCCCAGGGATCCCAGCGATATGAGCAGGTAAAGGTAATGTGCTCCGTGGTTCCCGAATAGAGCAGACTGTGCCCAAGGCCTACAGGACGCTCTCCGAACAGGTGGAGATTCCGGACTGCTGTGCTTTAAAA

Full Affymetrix probeset data:

Annotations for 1630177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720