Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630178_at:

>probe:Drosophila_2:1630178_at:571:541; Interrogation_Position=2205; Antisense; GGTTGATGGAGCACATCGCCGACGA
>probe:Drosophila_2:1630178_at:529:409; Interrogation_Position=2225; Antisense; GACGAGGATATCTCGGAGCCCTTTG
>probe:Drosophila_2:1630178_at:165:415; Interrogation_Position=2240; Antisense; GAGCCCTTTGTGGTGCCGAACAACA
>probe:Drosophila_2:1630178_at:255:189; Interrogation_Position=2261; Antisense; AACAGCATTGGAGACTGCGCCGCCA
>probe:Drosophila_2:1630178_at:155:339; Interrogation_Position=2320; Antisense; GCTCATGAGCATGGGCTTCGACGAA
>probe:Drosophila_2:1630178_at:41:213; Interrogation_Position=2344; Antisense; AAGACAGGCGGTGGCTGCTCTGAAA
>probe:Drosophila_2:1630178_at:401:715; Interrogation_Position=2408; Antisense; TTCTCGCACGCCGATTCAATTGGTG
>probe:Drosophila_2:1630178_at:459:249; Interrogation_Position=2424; Antisense; CAATTGGTGTTGAGGATGCTGCCCC
>probe:Drosophila_2:1630178_at:683:31; Interrogation_Position=2490; Antisense; ATAAGACCAACTACCGCGATGGCCG
>probe:Drosophila_2:1630178_at:420:357; Interrogation_Position=2517; Antisense; GCAAGTATCGCCTGGTGGCATTCAT
>probe:Drosophila_2:1630178_at:404:521; Interrogation_Position=2531; Antisense; GTGGCATTCATCTCACACATGGGCA
>probe:Drosophila_2:1630178_at:559:533; Interrogation_Position=2566; Antisense; GGTGGGACACTACGTTTGTCACATT
>probe:Drosophila_2:1630178_at:553:225; Interrogation_Position=2654; Antisense; AAGGACCTCGGCTATCTGTATCTGT
>probe:Drosophila_2:1630178_at:189:687; Interrogation_Position=2678; Antisense; TATATGCGCGAACAGTAGCCAGCCC

Paste this into a BLAST search page for me
GGTTGATGGAGCACATCGCCGACGAGACGAGGATATCTCGGAGCCCTTTGGAGCCCTTTGTGGTGCCGAACAACAAACAGCATTGGAGACTGCGCCGCCAGCTCATGAGCATGGGCTTCGACGAAAAGACAGGCGGTGGCTGCTCTGAAATTCTCGCACGCCGATTCAATTGGTGCAATTGGTGTTGAGGATGCTGCCCCATAAGACCAACTACCGCGATGGCCGGCAAGTATCGCCTGGTGGCATTCATGTGGCATTCATCTCACACATGGGCAGGTGGGACACTACGTTTGTCACATTAAGGACCTCGGCTATCTGTATCTGTTATATGCGCGAACAGTAGCCAGCCC

Full Affymetrix probeset data:

Annotations for 1630178_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime