Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630179_at:

>probe:Drosophila_2:1630179_at:322:67; Interrogation_Position=199; Antisense; AGGCGCGCCAAGTCGGATAAAATGT
>probe:Drosophila_2:1630179_at:474:219; Interrogation_Position=208; Antisense; AAGTCGGATAAAATGTGGCGGAATG
>probe:Drosophila_2:1630179_at:652:167; Interrogation_Position=218; Antisense; AAATGTGGCGGAATGAGAGTAAGAA
>probe:Drosophila_2:1630179_at:16:493; Interrogation_Position=236; Antisense; GTAAGAAATCAGAAAGCGACGCCGA
>probe:Drosophila_2:1630179_at:299:35; Interrogation_Position=243; Antisense; ATCAGAAAGCGACGCCGAGGCATCG
>probe:Drosophila_2:1630179_at:429:439; Interrogation_Position=259; Antisense; GAGGCATCGCCCGAGGTTGAATTTT
>probe:Drosophila_2:1630179_at:690:269; Interrogation_Position=263; Antisense; CATCGCCCGAGGTTGAATTTTATGC
>probe:Drosophila_2:1630179_at:601:339; Interrogation_Position=274; Antisense; GTTGAATTTTATGCGGCTAAGTCCG
>probe:Drosophila_2:1630179_at:561:699; Interrogation_Position=280; Antisense; TTTTATGCGGCTAAGTCCGCTGTCT
>probe:Drosophila_2:1630179_at:600:657; Interrogation_Position=291; Antisense; TAAGTCCGCTGTCTGGCACTTCGAG
>probe:Drosophila_2:1630179_at:650:297; Interrogation_Position=322; Antisense; CCGTCGCGTAAATCGAGGAGTTTTG
>probe:Drosophila_2:1630179_at:118:77; Interrogation_Position=337; Antisense; AGGAGTTTTGAGCATCAGCACCGGC
>probe:Drosophila_2:1630179_at:681:91; Interrogation_Position=340; Antisense; AGTTTTGAGCATCAGCACCGGCTGA
>probe:Drosophila_2:1630179_at:460:649; Interrogation_Position=351; Antisense; TCAGCACCGGCTGAAACACTCGTAA

Paste this into a BLAST search page for me
AGGCGCGCCAAGTCGGATAAAATGTAAGTCGGATAAAATGTGGCGGAATGAAATGTGGCGGAATGAGAGTAAGAAGTAAGAAATCAGAAAGCGACGCCGAATCAGAAAGCGACGCCGAGGCATCGGAGGCATCGCCCGAGGTTGAATTTTCATCGCCCGAGGTTGAATTTTATGCGTTGAATTTTATGCGGCTAAGTCCGTTTTATGCGGCTAAGTCCGCTGTCTTAAGTCCGCTGTCTGGCACTTCGAGCCGTCGCGTAAATCGAGGAGTTTTGAGGAGTTTTGAGCATCAGCACCGGCAGTTTTGAGCATCAGCACCGGCTGATCAGCACCGGCTGAAACACTCGTAA

Full Affymetrix probeset data:

Annotations for 1630179_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime