FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630180_at:

>probe:Drosophila_2:1630180_at:116:261; Interrogation_Position=233; Antisense; CAGCCCATTGTTTCGAAAACCTGAA
>probe:Drosophila_2:1630180_at:607:241; Interrogation_Position=256; Antisense; AATAGGTCTAAGTTCCACGTGATCG
>probe:Drosophila_2:1630180_at:222:263; Interrogation_Position=290; Antisense; CAGCGGAATTCACTTGGCACGGCAA
>probe:Drosophila_2:1630180_at:725:583; Interrogation_Position=304; Antisense; TGGCACGGCAACAACTTCAACAAGA
>probe:Drosophila_2:1630180_at:640:529; Interrogation_Position=393; Antisense; GGTGGCGAAGACCAAGTATCCCTTG
>probe:Drosophila_2:1630180_at:592:419; Interrogation_Position=420; Antisense; GAGCAAGTACATCGGCTACGCCCAG
>probe:Drosophila_2:1630180_at:216:501; Interrogation_Position=449; Antisense; GTCGATCGGTACTGCATCCAAGGGA
>probe:Drosophila_2:1630180_at:521:455; Interrogation_Position=472; Antisense; GATAAACTCATTGCAGCCGGTTGGG
>probe:Drosophila_2:1630180_at:406:589; Interrogation_Position=590; Antisense; TGGATCGCAAGATGCCACCCAATAT
>probe:Drosophila_2:1630180_at:134:243; Interrogation_Position=610; Antisense; AATATCATCTGTGCCGGTGCCTACA
>probe:Drosophila_2:1630180_at:440:159; Interrogation_Position=635; Antisense; ACAACAAGACTCTCTGCTTCGGCGA
>probe:Drosophila_2:1630180_at:79:525; Interrogation_Position=682; Antisense; GGGCGGCAAGTTTGTGGCATCAACA
>probe:Drosophila_2:1630180_at:196:157; Interrogation_Position=704; Antisense; ACACGTGGACTTTCAAATGCGGCAA
>probe:Drosophila_2:1630180_at:703:531; Interrogation_Position=753; Antisense; GGGTGTGCGATACTACGCCAAGTTT

Paste this into a BLAST search page for me
CAGCCCATTGTTTCGAAAACCTGAAAATAGGTCTAAGTTCCACGTGATCGCAGCGGAATTCACTTGGCACGGCAATGGCACGGCAACAACTTCAACAAGAGGTGGCGAAGACCAAGTATCCCTTGGAGCAAGTACATCGGCTACGCCCAGGTCGATCGGTACTGCATCCAAGGGAGATAAACTCATTGCAGCCGGTTGGGTGGATCGCAAGATGCCACCCAATATAATATCATCTGTGCCGGTGCCTACAACAACAAGACTCTCTGCTTCGGCGAGGGCGGCAAGTTTGTGGCATCAACAACACGTGGACTTTCAAATGCGGCAAGGGTGTGCGATACTACGCCAAGTTT

Full Affymetrix probeset data:

Annotations for 1630180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720