FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630181_at:

>probe:Drosophila_2:1630181_at:53:301; Interrogation_Position=2390; Antisense; CGCCGTCTGGGCATTCTTAAGGATG
>probe:Drosophila_2:1630181_at:625:475; Interrogation_Position=2458; Antisense; GTTATGACATCTGTTTTTTCCTAAA
>probe:Drosophila_2:1630181_at:171:307; Interrogation_Position=2477; Antisense; CCTAAATATGTTGGATGCTCTAATT
>probe:Drosophila_2:1630181_at:537:445; Interrogation_Position=2490; Antisense; GATGCTCTAATTATAAGGAACACAC
>probe:Drosophila_2:1630181_at:562:243; Interrogation_Position=2622; Antisense; AATTATAAAGCGCTTCCTTGGAAGG
>probe:Drosophila_2:1630181_at:608:717; Interrogation_Position=2635; Antisense; TTCCTTGGAAGGCATGACATCATTA
>probe:Drosophila_2:1630181_at:418:365; Interrogation_Position=2706; Antisense; GAATACCTTCTGATATATCTTAAAC
>probe:Drosophila_2:1630181_at:458:19; Interrogation_Position=2720; Antisense; ATATCTTAAACCTGCACTTGAACTA
>probe:Drosophila_2:1630181_at:204:459; Interrogation_Position=2747; Antisense; GATTTCCTTAACTTTACATAGCATA
>probe:Drosophila_2:1630181_at:522:415; Interrogation_Position=2842; Antisense; GAGCCAAACAAACACAGCGATCCGA
>probe:Drosophila_2:1630181_at:686:121; Interrogation_Position=2857; Antisense; AGCGATCCGAAATCCACTAACATAA
>probe:Drosophila_2:1630181_at:343:527; Interrogation_Position=2898; Antisense; GGGAGACTACTACTGTCATCGAATG
>probe:Drosophila_2:1630181_at:34:497; Interrogation_Position=2912; Antisense; GTCATCGAATGCAATCAGGCTACGT
>probe:Drosophila_2:1630181_at:84:571; Interrogation_Position=2929; Antisense; GGCTACGTTTTCTTTGTTGTGCTAA

Paste this into a BLAST search page for me
CGCCGTCTGGGCATTCTTAAGGATGGTTATGACATCTGTTTTTTCCTAAACCTAAATATGTTGGATGCTCTAATTGATGCTCTAATTATAAGGAACACACAATTATAAAGCGCTTCCTTGGAAGGTTCCTTGGAAGGCATGACATCATTAGAATACCTTCTGATATATCTTAAACATATCTTAAACCTGCACTTGAACTAGATTTCCTTAACTTTACATAGCATAGAGCCAAACAAACACAGCGATCCGAAGCGATCCGAAATCCACTAACATAAGGGAGACTACTACTGTCATCGAATGGTCATCGAATGCAATCAGGCTACGTGGCTACGTTTTCTTTGTTGTGCTAA

Full Affymetrix probeset data:

Annotations for 1630181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720