Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630182_at:

>probe:Drosophila_2:1630182_at:43:289; Interrogation_Position=1831; Antisense; CGGCGGCGACGCTTCAAAGCGATTA
>probe:Drosophila_2:1630182_at:203:133; Interrogation_Position=1839; Antisense; ACGCTTCAAAGCGATTATGCGCCAA
>probe:Drosophila_2:1630182_at:522:255; Interrogation_Position=1845; Antisense; CAAAGCGATTATGCGCCAACCGCGA
>probe:Drosophila_2:1630182_at:333:327; Interrogation_Position=1849; Antisense; GCGATTATGCGCCAACCGCGAGTCT
>probe:Drosophila_2:1630182_at:333:15; Interrogation_Position=1852; Antisense; ATTATGCGCCAACCGCGAGTCTCGT
>probe:Drosophila_2:1630182_at:573:249; Interrogation_Position=1861; Antisense; CAACCGCGAGTCTCGTGGCCGCTGG
>probe:Drosophila_2:1630182_at:482:521; Interrogation_Position=1875; Antisense; GTGGCCGCTGGCTATTCCTATGCAA
>probe:Drosophila_2:1630182_at:582:319; Interrogation_Position=1878; Antisense; GCCGCTGGCTATTCCTATGCAACAA
>probe:Drosophila_2:1630182_at:179:297; Interrogation_Position=1880; Antisense; CGCTGGCTATTCCTATGCAACAAGT
>probe:Drosophila_2:1630182_at:367:287; Interrogation_Position=1882; Antisense; CTGGCTATTCCTATGCAACAAGTGC
>probe:Drosophila_2:1630182_at:88:337; Interrogation_Position=1885; Antisense; GCTATTCCTATGCAACAAGTGCCGG
>probe:Drosophila_2:1630182_at:10:7; Interrogation_Position=1888; Antisense; ATTCCTATGCAACAAGTGCCGGCAG
>probe:Drosophila_2:1630182_at:534:159; Interrogation_Position=1899; Antisense; ACAAGTGCCGGCAGCCTGGACAACG
>probe:Drosophila_2:1630182_at:390:565; Interrogation_Position=1908; Antisense; GGCAGCCTGGACAACGGCCTCCGTT

Paste this into a BLAST search page for me
CGGCGGCGACGCTTCAAAGCGATTAACGCTTCAAAGCGATTATGCGCCAACAAAGCGATTATGCGCCAACCGCGAGCGATTATGCGCCAACCGCGAGTCTATTATGCGCCAACCGCGAGTCTCGTCAACCGCGAGTCTCGTGGCCGCTGGGTGGCCGCTGGCTATTCCTATGCAAGCCGCTGGCTATTCCTATGCAACAACGCTGGCTATTCCTATGCAACAAGTCTGGCTATTCCTATGCAACAAGTGCGCTATTCCTATGCAACAAGTGCCGGATTCCTATGCAACAAGTGCCGGCAGACAAGTGCCGGCAGCCTGGACAACGGGCAGCCTGGACAACGGCCTCCGTT

Full Affymetrix probeset data:

Annotations for 1630182_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime