FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630186_at:

>probe:Drosophila_2:1630186_at:688:33; Interrogation_Position=2955; Antisense; ATCATGGCCAAGGAACACGGGACAT
>probe:Drosophila_2:1630186_at:265:51; Interrogation_Position=2978; Antisense; ATGCCCAGGGCTTTTCTGAGATACA
>probe:Drosophila_2:1630186_at:366:195; Interrogation_Position=3028; Antisense; AACTGAACCTATCGCTTTTACACAA
>probe:Drosophila_2:1630186_at:215:345; Interrogation_Position=3082; Antisense; GCATACAATTTCCACAGACTTCCTG
>probe:Drosophila_2:1630186_at:649:105; Interrogation_Position=3097; Antisense; AGACTTCCTGTATATACACGCTATA
>probe:Drosophila_2:1630186_at:221:59; Interrogation_Position=3125; Antisense; ATGTAGATCCGCTTGTCGTACGATA
>probe:Drosophila_2:1630186_at:195:489; Interrogation_Position=3142; Antisense; GTACGATATTGCTCATCTCTTCACT
>probe:Drosophila_2:1630186_at:19:301; Interrogation_Position=3167; Antisense; CGCCAAATATCTCGTTGTATCTCTC
>probe:Drosophila_2:1630186_at:654:601; Interrogation_Position=3182; Antisense; TGTATCTCTCTTTTTAGCGCTATGC
>probe:Drosophila_2:1630186_at:595:7; Interrogation_Position=3293; Antisense; ATTGCCGTATTATGCATGTAGCTAC
>probe:Drosophila_2:1630186_at:553:441; Interrogation_Position=3351; Antisense; GATGTGATGCTATCTGACCGGAGGA
>probe:Drosophila_2:1630186_at:73:41; Interrogation_Position=3362; Antisense; ATCTGACCGGAGGATCGTGTGCGTA
>probe:Drosophila_2:1630186_at:609:159; Interrogation_Position=3402; Antisense; ACAACGCAGGCATATCCCAGAGATA
>probe:Drosophila_2:1630186_at:40:165; Interrogation_Position=3430; Antisense; AAATCCGATTTCATTCCAATAGTAT

Paste this into a BLAST search page for me
ATCATGGCCAAGGAACACGGGACATATGCCCAGGGCTTTTCTGAGATACAAACTGAACCTATCGCTTTTACACAAGCATACAATTTCCACAGACTTCCTGAGACTTCCTGTATATACACGCTATAATGTAGATCCGCTTGTCGTACGATAGTACGATATTGCTCATCTCTTCACTCGCCAAATATCTCGTTGTATCTCTCTGTATCTCTCTTTTTAGCGCTATGCATTGCCGTATTATGCATGTAGCTACGATGTGATGCTATCTGACCGGAGGAATCTGACCGGAGGATCGTGTGCGTAACAACGCAGGCATATCCCAGAGATAAAATCCGATTTCATTCCAATAGTAT

Full Affymetrix probeset data:

Annotations for 1630186_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720