FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630192_at:

>probe:Drosophila_2:1630192_at:155:621; Interrogation_Position=180; Antisense; TGCTCCCAGACAAGTCCCAGAGTTT
>probe:Drosophila_2:1630192_at:589:265; Interrogation_Position=197; Antisense; CAGAGTTTGCGGACGAACTGCGCGT
>probe:Drosophila_2:1630192_at:192:199; Interrogation_Position=232; Antisense; AACGTTTCGAGAACATCTGCCACCT
>probe:Drosophila_2:1630192_at:234:581; Interrogation_Position=262; Antisense; TGGCCAATGTGCTACGGCAGCCGGA
>probe:Drosophila_2:1630192_at:394:323; Interrogation_Position=304; Antisense; GCGACATCGATTGCCGCAACGTGAG
>probe:Drosophila_2:1630192_at:506:139; Interrogation_Position=377; Antisense; ACGTCCCGTCGTCTGCAAGAGATCA
>probe:Drosophila_2:1630192_at:632:125; Interrogation_Position=408; Antisense; AGCCAGCAAATCTGCGTGCGTAGCA
>probe:Drosophila_2:1630192_at:25:487; Interrogation_Position=427; Antisense; GTAGCAGGGACAACCGGCAGTGCAA
>probe:Drosophila_2:1630192_at:92:679; Interrogation_Position=464; Antisense; TAGTTGCCAGCTGCGCAACCAGAAT
>probe:Drosophila_2:1630192_at:196:111; Interrogation_Position=484; Antisense; AGAATTGCCACAGTCAGCCCAGGAA
>probe:Drosophila_2:1630192_at:724:73; Interrogation_Position=504; Antisense; AGGAACAACTGGCTGCGCACCGACA
>probe:Drosophila_2:1630192_at:349:155; Interrogation_Position=542; Antisense; ACAGCTGCAGCTGGGCGATAAGCCG
>probe:Drosophila_2:1630192_at:267:205; Interrogation_Position=561; Antisense; AAGCCGCAGAATTGCATCCGGGTGC
>probe:Drosophila_2:1630192_at:667:401; Interrogation_Position=724; Antisense; GACATCGGTGGCCAGACATTACAAT

Paste this into a BLAST search page for me
TGCTCCCAGACAAGTCCCAGAGTTTCAGAGTTTGCGGACGAACTGCGCGTAACGTTTCGAGAACATCTGCCACCTTGGCCAATGTGCTACGGCAGCCGGAGCGACATCGATTGCCGCAACGTGAGACGTCCCGTCGTCTGCAAGAGATCAAGCCAGCAAATCTGCGTGCGTAGCAGTAGCAGGGACAACCGGCAGTGCAATAGTTGCCAGCTGCGCAACCAGAATAGAATTGCCACAGTCAGCCCAGGAAAGGAACAACTGGCTGCGCACCGACAACAGCTGCAGCTGGGCGATAAGCCGAAGCCGCAGAATTGCATCCGGGTGCGACATCGGTGGCCAGACATTACAAT

Full Affymetrix probeset data:

Annotations for 1630192_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720