FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630193_at:

>probe:Drosophila_2:1630193_at:89:519; Interrogation_Position=3274; Antisense; GGCGGTAACTCGCAGTTAGCCAATG
>probe:Drosophila_2:1630193_at:249:251; Interrogation_Position=3294; Antisense; CAATGCGGGCTGTTATCCGTTGCAC
>probe:Drosophila_2:1630193_at:235:685; Interrogation_Position=3307; Antisense; TATCCGTTGCACTATGCGAGCAGCA
>probe:Drosophila_2:1630193_at:55:573; Interrogation_Position=3346; Antisense; GGCTACAATCGTCCCTTAGGTCAAA
>probe:Drosophila_2:1630193_at:12:257; Interrogation_Position=3367; Antisense; CAAAGATCAGGTGGCAACGGCTCCT
>probe:Drosophila_2:1630193_at:397:163; Interrogation_Position=3421; Antisense; AAATCGGACCTCTTCTTGTCCTACA
>probe:Drosophila_2:1630193_at:18:523; Interrogation_Position=3455; Antisense; GGGAGTACGAAAGACCCTACATATA
>probe:Drosophila_2:1630193_at:265:343; Interrogation_Position=3577; Antisense; GCTTACCACATTTCTGGGTCGCAGA
>probe:Drosophila_2:1630193_at:667:311; Interrogation_Position=3652; Antisense; GCCAACGACGTCATGTACTATCAGT
>probe:Drosophila_2:1630193_at:94:31; Interrogation_Position=3671; Antisense; ATCAGTTCGACAAAGGAGCCGCCGT
>probe:Drosophila_2:1630193_at:97:575; Interrogation_Position=3763; Antisense; GGCGGTCCATTAGTGTATCTGCAAC
>probe:Drosophila_2:1630193_at:568:69; Interrogation_Position=3788; Antisense; ATGGCCAGAATCCATCTGTGCCCGA
>probe:Drosophila_2:1630193_at:683:597; Interrogation_Position=3804; Antisense; TGTGCCCGAGGTGCAGCAGTCAACT
>probe:Drosophila_2:1630193_at:37:221; Interrogation_Position=3838; Antisense; AAGTGCAAACCTGTCGCATGTCGAT

Paste this into a BLAST search page for me
GGCGGTAACTCGCAGTTAGCCAATGCAATGCGGGCTGTTATCCGTTGCACTATCCGTTGCACTATGCGAGCAGCAGGCTACAATCGTCCCTTAGGTCAAACAAAGATCAGGTGGCAACGGCTCCTAAATCGGACCTCTTCTTGTCCTACAGGGAGTACGAAAGACCCTACATATAGCTTACCACATTTCTGGGTCGCAGAGCCAACGACGTCATGTACTATCAGTATCAGTTCGACAAAGGAGCCGCCGTGGCGGTCCATTAGTGTATCTGCAACATGGCCAGAATCCATCTGTGCCCGATGTGCCCGAGGTGCAGCAGTCAACTAAGTGCAAACCTGTCGCATGTCGAT

Full Affymetrix probeset data:

Annotations for 1630193_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720