FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630195_at:

>probe:Drosophila_2:1630195_at:718:519; Interrogation_Position=1021; Antisense; GTGGATGCCAGTCGTCGCTACAAAA
>probe:Drosophila_2:1630195_at:21:17; Interrogation_Position=1058; Antisense; ATTTTCTCCAAAACGTGCAGCAGCC
>probe:Drosophila_2:1630195_at:296:509; Interrogation_Position=1072; Antisense; GTGCAGCAGCCTATCGTTTTCATTG
>probe:Drosophila_2:1630195_at:157:275; Interrogation_Position=1092; Antisense; CATTGCAGGCGGTATCTTTCAGATA
>probe:Drosophila_2:1630195_at:313:217; Interrogation_Position=1144; Antisense; AAGTTTGCTTTCTCCGTGATAACCA
>probe:Drosophila_2:1630195_at:46:557; Interrogation_Position=624; Antisense; GGACTCTTACCCATTGATCTATACC
>probe:Drosophila_2:1630195_at:6:717; Interrogation_Position=656; Antisense; TTCGTGCTCACTTGGACATGCTAAG
>probe:Drosophila_2:1630195_at:128:381; Interrogation_Position=711; Antisense; GAACCTGAGCGAGGCCGAGAGCTAT
>probe:Drosophila_2:1630195_at:147:513; Interrogation_Position=754; Antisense; GTGATGGACCACAAGCTCATTCTAA
>probe:Drosophila_2:1630195_at:322:129; Interrogation_Position=814; Antisense; ACCATCTTCACACAGTTTCTGCTGA
>probe:Drosophila_2:1630195_at:277:455; Interrogation_Position=864; Antisense; GATCAACGTGTTTTTCTTCTCAGAC
>probe:Drosophila_2:1630195_at:706:407; Interrogation_Position=894; Antisense; GACGGGCATCGCATCATTTATGTTT
>probe:Drosophila_2:1630195_at:235:477; Interrogation_Position=919; Antisense; GTTATAACCATTTTGCTGCAGACCT
>probe:Drosophila_2:1630195_at:17:611; Interrogation_Position=992; Antisense; TGACCCATGCTATTTTCCAGTCCAA

Paste this into a BLAST search page for me
GTGGATGCCAGTCGTCGCTACAAAAATTTTCTCCAAAACGTGCAGCAGCCGTGCAGCAGCCTATCGTTTTCATTGCATTGCAGGCGGTATCTTTCAGATAAAGTTTGCTTTCTCCGTGATAACCAGGACTCTTACCCATTGATCTATACCTTCGTGCTCACTTGGACATGCTAAGGAACCTGAGCGAGGCCGAGAGCTATGTGATGGACCACAAGCTCATTCTAAACCATCTTCACACAGTTTCTGCTGAGATCAACGTGTTTTTCTTCTCAGACGACGGGCATCGCATCATTTATGTTTGTTATAACCATTTTGCTGCAGACCTTGACCCATGCTATTTTCCAGTCCAA

Full Affymetrix probeset data:

Annotations for 1630195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720