FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630196_at:

>probe:Drosophila_2:1630196_at:595:683; Interrogation_Position=1135; Antisense; TATAGACCCGAATACATCAAGTGTT
>probe:Drosophila_2:1630196_at:288:33; Interrogation_Position=1229; Antisense; ATCTGACAGGGTTTTAATCCGGACG
>probe:Drosophila_2:1630196_at:360:203; Interrogation_Position=1244; Antisense; AATCCGGACGTTGCTATACGCCAAA
>probe:Drosophila_2:1630196_at:644:25; Interrogation_Position=1259; Antisense; ATACGCCAAATTGCTTTTTATGTGC
>probe:Drosophila_2:1630196_at:591:293; Interrogation_Position=1382; Antisense; CGATGTTTGCTTGTATTTGTCCTAA
>probe:Drosophila_2:1630196_at:450:715; Interrogation_Position=1398; Antisense; TTGTCCTAAGCTATGTTAACCTACT
>probe:Drosophila_2:1630196_at:71:709; Interrogation_Position=1413; Antisense; TTAACCTACTACTTTGCCCGATTGG
>probe:Drosophila_2:1630196_at:317:3; Interrogation_Position=1433; Antisense; ATTGGCGGCCAGTTAAGAGTATAGA
>probe:Drosophila_2:1630196_at:541:491; Interrogation_Position=1482; Antisense; GTAAACTATTTTCTGGACTGACTCC
>probe:Drosophila_2:1630196_at:102:405; Interrogation_Position=1497; Antisense; GACTGACTCCTACATTGCCAGATTA
>probe:Drosophila_2:1630196_at:305:477; Interrogation_Position=1522; Antisense; GTTTATAGAAGCCTTCACCCCTAGC
>probe:Drosophila_2:1630196_at:240:643; Interrogation_Position=1536; Antisense; TCACCCCTAGCACGTTAACATTTTG
>probe:Drosophila_2:1630196_at:313:661; Interrogation_Position=1551; Antisense; TAACATTTTGTGCTGGTTCCATTTT
>probe:Drosophila_2:1630196_at:669:673; Interrogation_Position=1696; Antisense; TAGAATCCACGGAAGTCCTCATCGG

Paste this into a BLAST search page for me
TATAGACCCGAATACATCAAGTGTTATCTGACAGGGTTTTAATCCGGACGAATCCGGACGTTGCTATACGCCAAAATACGCCAAATTGCTTTTTATGTGCCGATGTTTGCTTGTATTTGTCCTAATTGTCCTAAGCTATGTTAACCTACTTTAACCTACTACTTTGCCCGATTGGATTGGCGGCCAGTTAAGAGTATAGAGTAAACTATTTTCTGGACTGACTCCGACTGACTCCTACATTGCCAGATTAGTTTATAGAAGCCTTCACCCCTAGCTCACCCCTAGCACGTTAACATTTTGTAACATTTTGTGCTGGTTCCATTTTTAGAATCCACGGAAGTCCTCATCGG

Full Affymetrix probeset data:

Annotations for 1630196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720