FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630198_at:

>probe:Drosophila_2:1630198_at:597:93; Interrogation_Position=443; Antisense; AGTTCCCACGGGTAATTCATTGCGT
>probe:Drosophila_2:1630198_at:476:11; Interrogation_Position=457; Antisense; ATTCATTGCGTTTCAATGGCCAAAC
>probe:Drosophila_2:1630198_at:300:305; Interrogation_Position=505; Antisense; CCGTGCTCAGTTCACCAGGACAGAG
>probe:Drosophila_2:1630198_at:60:75; Interrogation_Position=521; Antisense; AGGACAGAGCACTACCAAAGCAAGT
>probe:Drosophila_2:1630198_at:291:173; Interrogation_Position=537; Antisense; AAAGCAAGTGTCTTGCGGCCCATGA
>probe:Drosophila_2:1630198_at:655:269; Interrogation_Position=557; Antisense; CATGATCCGCACAACAGTGCTTGGA
>probe:Drosophila_2:1630198_at:684:499; Interrogation_Position=573; Antisense; GTGCTTGGAAGCGAAAAACAGACTC
>probe:Drosophila_2:1630198_at:378:239; Interrogation_Position=612; Antisense; AATCAAAATGGCCACCATGCGCCTT
>probe:Drosophila_2:1630198_at:349:49; Interrogation_Position=628; Antisense; ATGCGCCTTCCAACGGACGGAACAA
>probe:Drosophila_2:1630198_at:20:513; Interrogation_Position=642; Antisense; GGACGGAACAACTCTTCGAGCCCGA
>probe:Drosophila_2:1630198_at:324:717; Interrogation_Position=656; Antisense; TTCGAGCCCGAGCAGAGCCTCAAGT
>probe:Drosophila_2:1630198_at:481:413; Interrogation_Position=670; Antisense; GAGCCTCAAGTTCAAGTTCCTTTAA
>probe:Drosophila_2:1630198_at:700:363; Interrogation_Position=708; Antisense; GAATACCAAACAGACGACACCTGTG
>probe:Drosophila_2:1630198_at:493:393; Interrogation_Position=723; Antisense; GACACCTGTGTCTTAACTTATTTTT

Paste this into a BLAST search page for me
AGTTCCCACGGGTAATTCATTGCGTATTCATTGCGTTTCAATGGCCAAACCCGTGCTCAGTTCACCAGGACAGAGAGGACAGAGCACTACCAAAGCAAGTAAAGCAAGTGTCTTGCGGCCCATGACATGATCCGCACAACAGTGCTTGGAGTGCTTGGAAGCGAAAAACAGACTCAATCAAAATGGCCACCATGCGCCTTATGCGCCTTCCAACGGACGGAACAAGGACGGAACAACTCTTCGAGCCCGATTCGAGCCCGAGCAGAGCCTCAAGTGAGCCTCAAGTTCAAGTTCCTTTAAGAATACCAAACAGACGACACCTGTGGACACCTGTGTCTTAACTTATTTTT

Full Affymetrix probeset data:

Annotations for 1630198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720