FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630203_at:

>probe:Drosophila_2:1630203_at:58:127; Interrogation_Position=3623; Antisense; ACCAAAGGCATTTTCGTTTTATCAT
>probe:Drosophila_2:1630203_at:246:211; Interrogation_Position=3656; Antisense; AAGAGCCAGCTATGATTTTACCCCT
>probe:Drosophila_2:1630203_at:223:459; Interrogation_Position=3669; Antisense; GATTTTACCCCTGAGATCTTATAGG
>probe:Drosophila_2:1630203_at:265:665; Interrogation_Position=3688; Antisense; TATAGGATTAACCTTCCCTTGTACT
>probe:Drosophila_2:1630203_at:554:695; Interrogation_Position=3701; Antisense; TTCCCTTGTACTCCAATACACGAAG
>probe:Drosophila_2:1630203_at:719:665; Interrogation_Position=3717; Antisense; TACACGAAGATCTCGGTGACCGGCT
>probe:Drosophila_2:1630203_at:46:513; Interrogation_Position=3732; Antisense; GTGACCGGCTCATCCATATAATCAA
>probe:Drosophila_2:1630203_at:354:175; Interrogation_Position=3774; Antisense; AAACCAACTTCGTTAGGATGCGAGT
>probe:Drosophila_2:1630203_at:476:77; Interrogation_Position=3788; Antisense; AGGATGCGAGTCCAAAGGCAGTCTC
>probe:Drosophila_2:1630203_at:67:169; Interrogation_Position=3801; Antisense; AAAGGCAGTCTCGAAATCCGTGATC
>probe:Drosophila_2:1630203_at:512:397; Interrogation_Position=3854; Antisense; GACAACATATCTGTGAATCGACTAG
>probe:Drosophila_2:1630203_at:407:697; Interrogation_Position=3940; Antisense; TTTCTTTCCATTTTGGTGTTTCCAT
>probe:Drosophila_2:1630203_at:464:157; Interrogation_Position=3981; Antisense; ACAAATTTACTACTTCAGTCGATAG
>probe:Drosophila_2:1630203_at:304:363; Interrogation_Position=4023; Antisense; GAATTCATATGCCTAAAACTACGAT

Paste this into a BLAST search page for me
ACCAAAGGCATTTTCGTTTTATCATAAGAGCCAGCTATGATTTTACCCCTGATTTTACCCCTGAGATCTTATAGGTATAGGATTAACCTTCCCTTGTACTTTCCCTTGTACTCCAATACACGAAGTACACGAAGATCTCGGTGACCGGCTGTGACCGGCTCATCCATATAATCAAAAACCAACTTCGTTAGGATGCGAGTAGGATGCGAGTCCAAAGGCAGTCTCAAAGGCAGTCTCGAAATCCGTGATCGACAACATATCTGTGAATCGACTAGTTTCTTTCCATTTTGGTGTTTCCATACAAATTTACTACTTCAGTCGATAGGAATTCATATGCCTAAAACTACGAT

Full Affymetrix probeset data:

Annotations for 1630203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720