FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630206_at:

>probe:Drosophila_2:1630206_at:617:605; Interrogation_Position=3668; Antisense; TGATCATCCAGTTCCTGGCGATGTT
>probe:Drosophila_2:1630206_at:109:147; Interrogation_Position=3730; Antisense; ACTACTCAGGTGGACTGGTTTCGAA
>probe:Drosophila_2:1630206_at:718:349; Interrogation_Position=3800; Antisense; GCAGTGCTGTCAGTATAGCCCGGAA
>probe:Drosophila_2:1630206_at:563:215; Interrogation_Position=3823; Antisense; AAGTTGCAGCGACCCAAGAGGCTCT
>probe:Drosophila_2:1630206_at:644:63; Interrogation_Position=3925; Antisense; ATGGTGCGACGGCAGACGATCTTTC
>probe:Drosophila_2:1630206_at:313:453; Interrogation_Position=3942; Antisense; GATCTTTCGGCTTCACGAGACGCGG
>probe:Drosophila_2:1630206_at:132:115; Interrogation_Position=3971; Antisense; AGCAGCACAGCGACTACAGCAATCT
>probe:Drosophila_2:1630206_at:159:613; Interrogation_Position=4008; Antisense; TGAACGCCGTTTCTTTGGAGACGAC
>probe:Drosophila_2:1630206_at:633:551; Interrogation_Position=4024; Antisense; GGAGACGACGAGCTGAACCTTAAGA
>probe:Drosophila_2:1630206_at:83:363; Interrogation_Position=4047; Antisense; GAATCTGGCACTCAACCGAAAGTCA
>probe:Drosophila_2:1630206_at:699:173; Interrogation_Position=4155; Antisense; AAAGCGACCGCCTGTGGTGCCGATG
>probe:Drosophila_2:1630206_at:47:373; Interrogation_Position=4185; Antisense; GAAGGTGAGCTTTACGGCCTCAAAC
>probe:Drosophila_2:1630206_at:240:3; Interrogation_Position=4219; Antisense; ATGGCTTTGTACGACAACGGCGGGT
>probe:Drosophila_2:1630206_at:608:191; Interrogation_Position=4234; Antisense; AACGGCGGGTACGAGCACACCGAGT

Paste this into a BLAST search page for me
TGATCATCCAGTTCCTGGCGATGTTACTACTCAGGTGGACTGGTTTCGAAGCAGTGCTGTCAGTATAGCCCGGAAAAGTTGCAGCGACCCAAGAGGCTCTATGGTGCGACGGCAGACGATCTTTCGATCTTTCGGCTTCACGAGACGCGGAGCAGCACAGCGACTACAGCAATCTTGAACGCCGTTTCTTTGGAGACGACGGAGACGACGAGCTGAACCTTAAGAGAATCTGGCACTCAACCGAAAGTCAAAAGCGACCGCCTGTGGTGCCGATGGAAGGTGAGCTTTACGGCCTCAAACATGGCTTTGTACGACAACGGCGGGTAACGGCGGGTACGAGCACACCGAGT

Full Affymetrix probeset data:

Annotations for 1630206_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720