FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630207_at:

>probe:Drosophila_2:1630207_at:439:65; Interrogation_Position=5287; Antisense; ATGGAGCTCAGCGTTTTTATGCCCG
>probe:Drosophila_2:1630207_at:409:221; Interrogation_Position=5323; Antisense; AAGTGATCGAGATGTCCCCGCAATC
>probe:Drosophila_2:1630207_at:35:303; Interrogation_Position=5339; Antisense; CCCGCAATCCCTAACTGTAGATAGT
>probe:Drosophila_2:1630207_at:362:457; Interrogation_Position=5358; Antisense; GATAGTATCGCCAATCACATGTTGA
>probe:Drosophila_2:1630207_at:214:259; Interrogation_Position=5373; Antisense; CACATGTTGAAATTGGCTGTCCAGC
>probe:Drosophila_2:1630207_at:291:505; Interrogation_Position=5391; Antisense; GTCCAGCAGACCCAATCGGCGTAGA
>probe:Drosophila_2:1630207_at:210:569; Interrogation_Position=5408; Antisense; GGCGTAGACCTGTGTCGCGGAACTA
>probe:Drosophila_2:1630207_at:119:425; Interrogation_Position=5441; Antisense; GAGAGTCTCGGCCTTGAACAAAGTT
>probe:Drosophila_2:1630207_at:369:23; Interrogation_Position=5500; Antisense; ATATCACCCAGAATACCCGATCTAT
>probe:Drosophila_2:1630207_at:369:31; Interrogation_Position=5523; Antisense; ATAAATGTGCTTTTGGCTGTCTGCC
>probe:Drosophila_2:1630207_at:675:571; Interrogation_Position=5537; Antisense; GGCTGTCTGCCCAAGTATAGTTCAA
>probe:Drosophila_2:1630207_at:398:239; Interrogation_Position=5576; Antisense; AATAAGTTGCGTGTTAAGCCCTGTA
>probe:Drosophila_2:1630207_at:681:659; Interrogation_Position=5590; Antisense; TAAGCCCTGTAGTCCTAACAATCAT
>probe:Drosophila_2:1630207_at:226:481; Interrogation_Position=5763; Antisense; GTTTGATTTGCTACTATCGACTGAA

Paste this into a BLAST search page for me
ATGGAGCTCAGCGTTTTTATGCCCGAAGTGATCGAGATGTCCCCGCAATCCCCGCAATCCCTAACTGTAGATAGTGATAGTATCGCCAATCACATGTTGACACATGTTGAAATTGGCTGTCCAGCGTCCAGCAGACCCAATCGGCGTAGAGGCGTAGACCTGTGTCGCGGAACTAGAGAGTCTCGGCCTTGAACAAAGTTATATCACCCAGAATACCCGATCTATATAAATGTGCTTTTGGCTGTCTGCCGGCTGTCTGCCCAAGTATAGTTCAAAATAAGTTGCGTGTTAAGCCCTGTATAAGCCCTGTAGTCCTAACAATCATGTTTGATTTGCTACTATCGACTGAA

Full Affymetrix probeset data:

Annotations for 1630207_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720