Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630208_at:

>probe:Drosophila_2:1630208_at:143:235; Interrogation_Position=1301; Antisense; AATCCCGGCGGGTCAGATCAAGAAG
>probe:Drosophila_2:1630208_at:59:141; Interrogation_Position=1339; Antisense; ACGTGAGCAAACATGGTCTCCTCCA
>probe:Drosophila_2:1630208_at:439:409; Interrogation_Position=1389; Antisense; GACGACACTCTGATCGAGCTGTATG
>probe:Drosophila_2:1630208_at:539:695; Interrogation_Position=1426; Antisense; TTTCGCTAAGCGAGATGTGCTCCCT
>probe:Drosophila_2:1630208_at:405:145; Interrogation_Position=1471; Antisense; ACTCCTACCAGATGTGCAGCGGCAA
>probe:Drosophila_2:1630208_at:660:329; Interrogation_Position=1492; Antisense; GCAAAGATACGAGCGGGAAGCCCCT
>probe:Drosophila_2:1630208_at:613:333; Interrogation_Position=1562; Antisense; GCTGGTCAGCAACATCGAGGCGTAC
>probe:Drosophila_2:1630208_at:157:287; Interrogation_Position=1596; Antisense; CTGGCCGAGTTCATCAAGCTGTGCA
>probe:Drosophila_2:1630208_at:612:137; Interrogation_Position=1672; Antisense; ACGAGCAGCTGCAAATCCAGGGCAA
>probe:Drosophila_2:1630208_at:558:79; Interrogation_Position=1690; Antisense; AGGGCAACCAGGTGCGATTTGTGCA
>probe:Drosophila_2:1630208_at:282:617; Interrogation_Position=1711; Antisense; TGCACACGCTGCTCACGGAAACGTA
>probe:Drosophila_2:1630208_at:398:559; Interrogation_Position=1727; Antisense; GGAAACGTACAAGGTGCCGCCCAAG
>probe:Drosophila_2:1630208_at:134:311; Interrogation_Position=1747; Antisense; CCAAGTGCATCCTGGGCCTGGAATT
>probe:Drosophila_2:1630208_at:226:303; Interrogation_Position=1830; Antisense; CCGCCTGTCCTCTTGAGTGTAATAA

Paste this into a BLAST search page for me
AATCCCGGCGGGTCAGATCAAGAAGACGTGAGCAAACATGGTCTCCTCCAGACGACACTCTGATCGAGCTGTATGTTTCGCTAAGCGAGATGTGCTCCCTACTCCTACCAGATGTGCAGCGGCAAGCAAAGATACGAGCGGGAAGCCCCTGCTGGTCAGCAACATCGAGGCGTACCTGGCCGAGTTCATCAAGCTGTGCAACGAGCAGCTGCAAATCCAGGGCAAAGGGCAACCAGGTGCGATTTGTGCATGCACACGCTGCTCACGGAAACGTAGGAAACGTACAAGGTGCCGCCCAAGCCAAGTGCATCCTGGGCCTGGAATTCCGCCTGTCCTCTTGAGTGTAATAA

Full Affymetrix probeset data:

Annotations for 1630208_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime