Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630209_at:

>probe:Drosophila_2:1630209_at:420:531; Interrogation_Position=1053; Antisense; GGGTCAACTATGTCCGCCAGGGAGC
>probe:Drosophila_2:1630209_at:580:409; Interrogation_Position=1090; Antisense; GACGCAGAAGTACCCGGACGCCATG
>probe:Drosophila_2:1630209_at:587:555; Interrogation_Position=1105; Antisense; GGACGCCATGAACCACTGCGACTTT
>probe:Drosophila_2:1630209_at:154:579; Interrogation_Position=1151; Antisense; GGCCAGCTTTACGATCACCAGGTGG
>probe:Drosophila_2:1630209_at:213:33; Interrogation_Position=1164; Antisense; ATCACCAGGTGGTCTACCGCTTTGG
>probe:Drosophila_2:1630209_at:222:281; Interrogation_Position=1189; Antisense; CTCTTGTCCCAAGCGAGTGTAGCAA
>probe:Drosophila_2:1630209_at:458:445; Interrogation_Position=1221; Antisense; GATGCTCCCAAAATTAGGCCGCTAA
>probe:Drosophila_2:1630209_at:411:625; Interrogation_Position=765; Antisense; TGCCCACCGGGAAGCTGATGCGCGT
>probe:Drosophila_2:1630209_at:577:593; Interrogation_Position=828; Antisense; TGGGCAAGCGGCTCAACCAGGTGTC
>probe:Drosophila_2:1630209_at:49:297; Interrogation_Position=874; Antisense; CGACAACCATTTCTGCGTGGACATT
>probe:Drosophila_2:1630209_at:614:149; Interrogation_Position=894; Antisense; ACATTCCTCCAAACCGGGTGCAATT
>probe:Drosophila_2:1630209_at:393:83; Interrogation_Position=928; Antisense; AGTGGTTCACCCATGCAGTGGCCGG
>probe:Drosophila_2:1630209_at:626:577; Interrogation_Position=947; Antisense; GGCCGGTTCATGGAGGTGCACACCA
>probe:Drosophila_2:1630209_at:172:575; Interrogation_Position=997; Antisense; GGCGAACCATTTGCCGAGCGAGGAC

Paste this into a BLAST search page for me
GGGTCAACTATGTCCGCCAGGGAGCGACGCAGAAGTACCCGGACGCCATGGGACGCCATGAACCACTGCGACTTTGGCCAGCTTTACGATCACCAGGTGGATCACCAGGTGGTCTACCGCTTTGGCTCTTGTCCCAAGCGAGTGTAGCAAGATGCTCCCAAAATTAGGCCGCTAATGCCCACCGGGAAGCTGATGCGCGTTGGGCAAGCGGCTCAACCAGGTGTCCGACAACCATTTCTGCGTGGACATTACATTCCTCCAAACCGGGTGCAATTAGTGGTTCACCCATGCAGTGGCCGGGGCCGGTTCATGGAGGTGCACACCAGGCGAACCATTTGCCGAGCGAGGAC

Full Affymetrix probeset data:

Annotations for 1630209_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime