FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630210_at:

>probe:Drosophila_2:1630210_at:81:445; Interrogation_Position=1037; Antisense; GATGACTCCATCGACTTCATTTGGC
>probe:Drosophila_2:1630210_at:610:677; Interrogation_Position=1122; Antisense; TAGTCTACGATGAACCCGAACCACA
>probe:Drosophila_2:1630210_at:502:629; Interrogation_Position=1176; Antisense; TCCGACGTTTGGATGTGGCCAGTTC
>probe:Drosophila_2:1630210_at:425:531; Interrogation_Position=1201; Antisense; GGGTATATATCATCCCACTCTGGTG
>probe:Drosophila_2:1630210_at:514:259; Interrogation_Position=1216; Antisense; CACTCTGGTGCCTCTGGAAGACAAA
>probe:Drosophila_2:1630210_at:695:621; Interrogation_Position=1257; Antisense; TGCTGCACTGCGTCTATGCCAAAAA
>probe:Drosophila_2:1630210_at:173:591; Interrogation_Position=1323; Antisense; TGGTCCACTTCTACTCCGAAGGAGT
>probe:Drosophila_2:1630210_at:12:421; Interrogation_Position=1352; Antisense; GAGCACGGATTCTTTATGGCCACCT
>probe:Drosophila_2:1630210_at:479:691; Interrogation_Position=1365; Antisense; TTATGGCCACCTTGCGGTCCGTAAA
>probe:Drosophila_2:1630210_at:577:395; Interrogation_Position=1402; Antisense; GACAATGACCGCACGGTACGGTGTT
>probe:Drosophila_2:1630210_at:252:515; Interrogation_Position=1422; Antisense; GTGTTAATCGCAAGGAGCTGCCCAA
>probe:Drosophila_2:1630210_at:133:565; Interrogation_Position=856; Antisense; GGAATATCTAATTCGCTTCGAGACG
>probe:Drosophila_2:1630210_at:631:219; Interrogation_Position=890; Antisense; AAGTGCTTGAATCCACCCAGAACGG
>probe:Drosophila_2:1630210_at:328:433; Interrogation_Position=941; Antisense; GAGTGCCAGGATGAGGTCCGCAACA

Paste this into a BLAST search page for me
GATGACTCCATCGACTTCATTTGGCTAGTCTACGATGAACCCGAACCACATCCGACGTTTGGATGTGGCCAGTTCGGGTATATATCATCCCACTCTGGTGCACTCTGGTGCCTCTGGAAGACAAATGCTGCACTGCGTCTATGCCAAAAATGGTCCACTTCTACTCCGAAGGAGTGAGCACGGATTCTTTATGGCCACCTTTATGGCCACCTTGCGGTCCGTAAAGACAATGACCGCACGGTACGGTGTTGTGTTAATCGCAAGGAGCTGCCCAAGGAATATCTAATTCGCTTCGAGACGAAGTGCTTGAATCCACCCAGAACGGGAGTGCCAGGATGAGGTCCGCAACA

Full Affymetrix probeset data:

Annotations for 1630210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720