FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630212_at:

>probe:Drosophila_2:1630212_at:146:105; Interrogation_Position=1004; Antisense; AGACTGGAAAGTTCCTCTGGGCGGA
>probe:Drosophila_2:1630212_at:393:517; Interrogation_Position=1038; Antisense; GTGGACCGGCGTGAATTCAACCAAA
>probe:Drosophila_2:1630212_at:528:209; Interrogation_Position=1070; Antisense; AAGCAACCATTAGTTTATCCCTCGC
>probe:Drosophila_2:1630212_at:519:245; Interrogation_Position=1174; Antisense; AATTCTTACGGATTCTACAAGCTGA
>probe:Drosophila_2:1630212_at:287:219; Interrogation_Position=667; Antisense; AAGTCGTACAGCAGAATCGGTGCCT
>probe:Drosophila_2:1630212_at:216:367; Interrogation_Position=680; Antisense; GAATCGGTGCCTATAGTCAGAGCAA
>probe:Drosophila_2:1630212_at:415:679; Interrogation_Position=693; Antisense; TAGTCAGAGCAAGCTGGCCAACGTC
>probe:Drosophila_2:1630212_at:687:371; Interrogation_Position=816; Antisense; GAAGTTCCTGAAACACCCCTTTGCA
>probe:Drosophila_2:1630212_at:615:593; Interrogation_Position=863; Antisense; TGTGGGTACTCTTCAAAACCCCTCG
>probe:Drosophila_2:1630212_at:306:361; Interrogation_Position=887; Antisense; GCAATGGAGCGCAGACCACTCTCTA
>probe:Drosophila_2:1630212_at:155:125; Interrogation_Position=915; Antisense; AGCCCTGGATCCTGCACTAAAGGAT
>probe:Drosophila_2:1630212_at:103:663; Interrogation_Position=932; Antisense; TAAAGGATGTTTCCGGGCTCTACTT
>probe:Drosophila_2:1630212_at:60:669; Interrogation_Position=952; Antisense; TACTTTAGCGACTGCCAGCCAAAGG
>probe:Drosophila_2:1630212_at:15:257; Interrogation_Position=971; Antisense; CAAAGGAAGTGTCCGCAGCTGCCCA

Paste this into a BLAST search page for me
AGACTGGAAAGTTCCTCTGGGCGGAGTGGACCGGCGTGAATTCAACCAAAAAGCAACCATTAGTTTATCCCTCGCAATTCTTACGGATTCTACAAGCTGAAAGTCGTACAGCAGAATCGGTGCCTGAATCGGTGCCTATAGTCAGAGCAATAGTCAGAGCAAGCTGGCCAACGTCGAAGTTCCTGAAACACCCCTTTGCATGTGGGTACTCTTCAAAACCCCTCGGCAATGGAGCGCAGACCACTCTCTAAGCCCTGGATCCTGCACTAAAGGATTAAAGGATGTTTCCGGGCTCTACTTTACTTTAGCGACTGCCAGCCAAAGGCAAAGGAAGTGTCCGCAGCTGCCCA

Full Affymetrix probeset data:

Annotations for 1630212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720