Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630213_at:

>probe:Drosophila_2:1630213_at:51:317; Interrogation_Position=1605; Antisense; GCCTACGACGACGATCGTGAGCGCA
>probe:Drosophila_2:1630213_at:158:169; Interrogation_Position=1673; Antisense; AAAGGACTTCCTTGACATGCTGCGG
>probe:Drosophila_2:1630213_at:57:621; Interrogation_Position=1690; Antisense; TGCTGCGGGAGCGACATGACATCGA
>probe:Drosophila_2:1630213_at:640:259; Interrogation_Position=1709; Antisense; CATCGAAAGGCACACCAGGTGGTAC
>probe:Drosophila_2:1630213_at:611:437; Interrogation_Position=1752; Antisense; GAGGCGGATCCAAGGTACCGAGCCC
>probe:Drosophila_2:1630213_at:337:555; Interrogation_Position=1778; Antisense; GGACTCGTCCTATCGTGAGGAGTAC
>probe:Drosophila_2:1630213_at:179:275; Interrogation_Position=1802; Antisense; CTTCGAAGACTATTTGCACCTGCTG
>probe:Drosophila_2:1630213_at:113:563; Interrogation_Position=1859; Antisense; GGAACGTGAACGACATCGCGACAAA
>probe:Drosophila_2:1630213_at:613:213; Interrogation_Position=1882; Antisense; AAGAGCGGTCTCGTGACAAGGACAA
>probe:Drosophila_2:1630213_at:670:77; Interrogation_Position=1996; Antisense; AGGATAAAGAGAGCTCCCGTCGGGA
>probe:Drosophila_2:1630213_at:195:417; Interrogation_Position=2019; Antisense; GAGCGCTCTCGATCTCGCGAAAAGT
>probe:Drosophila_2:1630213_at:675:183; Interrogation_Position=2038; Antisense; AAAAGTCCAGCCGTCGCAAGTCCAA
>probe:Drosophila_2:1630213_at:556:361; Interrogation_Position=2053; Antisense; GCAAGTCCAAGTCCCGTGAGAAAGA
>probe:Drosophila_2:1630213_at:518:485; Interrogation_Position=2101; Antisense; GTAGCAGCAGCAATACCGGAGGATC

Paste this into a BLAST search page for me
GCCTACGACGACGATCGTGAGCGCAAAAGGACTTCCTTGACATGCTGCGGTGCTGCGGGAGCGACATGACATCGACATCGAAAGGCACACCAGGTGGTACGAGGCGGATCCAAGGTACCGAGCCCGGACTCGTCCTATCGTGAGGAGTACCTTCGAAGACTATTTGCACCTGCTGGGAACGTGAACGACATCGCGACAAAAAGAGCGGTCTCGTGACAAGGACAAAGGATAAAGAGAGCTCCCGTCGGGAGAGCGCTCTCGATCTCGCGAAAAGTAAAAGTCCAGCCGTCGCAAGTCCAAGCAAGTCCAAGTCCCGTGAGAAAGAGTAGCAGCAGCAATACCGGAGGATC

Full Affymetrix probeset data:

Annotations for 1630213_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime