Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630214_a_at:

>probe:Drosophila_2:1630214_a_at:564:519; Interrogation_Position=1000; Antisense; GTGGACTACAAGTTGCGCTATGGCA
>probe:Drosophila_2:1630214_a_at:388:69; Interrogation_Position=1030; Antisense; ATGGCCCAGATCCAGCTCATTTTAA
>probe:Drosophila_2:1630214_a_at:61:461; Interrogation_Position=1066; Antisense; GATTTGCCATCGGAGTTCGACAACT
>probe:Drosophila_2:1630214_a_at:9:161; Interrogation_Position=521; Antisense; ACAACCTGACGATGGCCCTGGTGGA
>probe:Drosophila_2:1630214_a_at:605:175; Interrogation_Position=557; Antisense; AAGACGGCCGTCTGCTTAACGAAAG
>probe:Drosophila_2:1630214_a_at:549:675; Interrogation_Position=666; Antisense; TAGCTCAGACGTAGTTCGTGGCCAC
>probe:Drosophila_2:1630214_a_at:51:223; Interrogation_Position=721; Antisense; AAGGTATTCCTGTCGGACTGTGTTG
>probe:Drosophila_2:1630214_a_at:658:461; Interrogation_Position=750; Antisense; GATTAGCAACTCGTGGCATGACATG
>probe:Drosophila_2:1630214_a_at:154:347; Interrogation_Position=765; Antisense; GCATGACATGCGCATCAAGCTCGTC
>probe:Drosophila_2:1630214_a_at:236:207; Interrogation_Position=781; Antisense; AAGCTCGTCCATGTCAGCGATGTAC
>probe:Drosophila_2:1630214_a_at:383:123; Interrogation_Position=796; Antisense; AGCGATGTACCATTTGCGCCTCAGG
>probe:Drosophila_2:1630214_a_at:184:555; Interrogation_Position=849; Antisense; GGACCACAACCGGATCATGATCTGC
>probe:Drosophila_2:1630214_a_at:520:451; Interrogation_Position=867; Antisense; GATCTGCTTGAGAGCCCAGAACCTA
>probe:Drosophila_2:1630214_a_at:637:427; Interrogation_Position=940; Antisense; GAGATCAGTCAGAGTTTCCTGCTCC

Paste this into a BLAST search page for me
GTGGACTACAAGTTGCGCTATGGCAATGGCCCAGATCCAGCTCATTTTAAGATTTGCCATCGGAGTTCGACAACTACAACCTGACGATGGCCCTGGTGGAAAGACGGCCGTCTGCTTAACGAAAGTAGCTCAGACGTAGTTCGTGGCCACAAGGTATTCCTGTCGGACTGTGTTGGATTAGCAACTCGTGGCATGACATGGCATGACATGCGCATCAAGCTCGTCAAGCTCGTCCATGTCAGCGATGTACAGCGATGTACCATTTGCGCCTCAGGGGACCACAACCGGATCATGATCTGCGATCTGCTTGAGAGCCCAGAACCTAGAGATCAGTCAGAGTTTCCTGCTCC

Full Affymetrix probeset data:

Annotations for 1630214_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime