FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630216_at:

>probe:Drosophila_2:1630216_at:366:559; Interrogation_Position=3774; Antisense; GGACAACGACAGTGATCGCCAGCAT
>probe:Drosophila_2:1630216_at:378:33; Interrogation_Position=3811; Antisense; ATCAAGCGGCCCAAATATGCGACAC
>probe:Drosophila_2:1630216_at:543:51; Interrogation_Position=3827; Antisense; ATGCGACACCGCTTCAGGATGAGAG
>probe:Drosophila_2:1630216_at:210:445; Interrogation_Position=3844; Antisense; GATGAGAGCCATCTTCCTAAGCAAT
>probe:Drosophila_2:1630216_at:136:191; Interrogation_Position=3883; Antisense; AACATTTCCAGCGATGAGTTGCCGG
>probe:Drosophila_2:1630216_at:241:375; Interrogation_Position=3913; Antisense; GAAGACTTCGAAAGCACTGCTCCCA
>probe:Drosophila_2:1630216_at:529:431; Interrogation_Position=3939; Antisense; GAGTCCAACAATGCCCTTAAGAAGT
>probe:Drosophila_2:1630216_at:392:605; Interrogation_Position=3999; Antisense; TGATAGCGATGGCTCAACCTCTTCT
>probe:Drosophila_2:1630216_at:360:715; Interrogation_Position=4020; Antisense; TTCTCCGAAGTGCAAGCGCCGATTA
>probe:Drosophila_2:1630216_at:7:107; Interrogation_Position=4046; Antisense; AGAAATGTTCCTCGGTGTCTTCAAA
>probe:Drosophila_2:1630216_at:7:535; Interrogation_Position=4059; Antisense; GGTGTCTTCAAAATCTTCGCTGGGA
>probe:Drosophila_2:1630216_at:121:707; Interrogation_Position=4187; Antisense; TTAGTAGATGCAATTCTCCCCTTTG
>probe:Drosophila_2:1630216_at:363:631; Interrogation_Position=4203; Antisense; TCCCCTTTGCTATCAGGACATCTTA
>probe:Drosophila_2:1630216_at:151:245; Interrogation_Position=4256; Antisense; AATTTGCCTGTCTCTAATTGTCGCC

Paste this into a BLAST search page for me
GGACAACGACAGTGATCGCCAGCATATCAAGCGGCCCAAATATGCGACACATGCGACACCGCTTCAGGATGAGAGGATGAGAGCCATCTTCCTAAGCAATAACATTTCCAGCGATGAGTTGCCGGGAAGACTTCGAAAGCACTGCTCCCAGAGTCCAACAATGCCCTTAAGAAGTTGATAGCGATGGCTCAACCTCTTCTTTCTCCGAAGTGCAAGCGCCGATTAAGAAATGTTCCTCGGTGTCTTCAAAGGTGTCTTCAAAATCTTCGCTGGGATTAGTAGATGCAATTCTCCCCTTTGTCCCCTTTGCTATCAGGACATCTTAAATTTGCCTGTCTCTAATTGTCGCC

Full Affymetrix probeset data:

Annotations for 1630216_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720