FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630217_at:

>probe:Drosophila_2:1630217_at:243:657; Interrogation_Position=1570; Antisense; TAATGCTGTATTGCCGCCATATCTG
>probe:Drosophila_2:1630217_at:616:39; Interrogation_Position=1590; Antisense; ATCTGCACTATGCTTCTGTTGGTGT
>probe:Drosophila_2:1630217_at:494:615; Interrogation_Position=1635; Antisense; TGCGTTCCATCACAAAATCGTTCGA
>probe:Drosophila_2:1630217_at:23:293; Interrogation_Position=1673; Antisense; CGTTGTGTGCCGCATTCTGTAAATA
>probe:Drosophila_2:1630217_at:561:687; Interrogation_Position=1696; Antisense; TATATTCTCGAACTACAGCCGCATG
>probe:Drosophila_2:1630217_at:89:459; Interrogation_Position=1750; Antisense; GATATCATACCACTCAATGCTTTCC
>probe:Drosophila_2:1630217_at:68:403; Interrogation_Position=1803; Antisense; GACTACCTGGTCTGAATCTAACGCC
>probe:Drosophila_2:1630217_at:210:659; Interrogation_Position=1821; Antisense; TAACGCCGACGCAAATCTTCTTTTT
>probe:Drosophila_2:1630217_at:343:719; Interrogation_Position=1849; Antisense; TTCCGCCCAGGAACTGTGTGCTGAA
>probe:Drosophila_2:1630217_at:304:515; Interrogation_Position=1864; Antisense; GTGTGCTGAATCGAACTACTTGGGC
>probe:Drosophila_2:1630217_at:568:451; Interrogation_Position=1892; Antisense; GATACAAACGCTCCCGAATTCGATA
>probe:Drosophila_2:1630217_at:695:21; Interrogation_Position=1917; Antisense; ATATATTGGGTTGGCTCGTTGCCCA
>probe:Drosophila_2:1630217_at:564:229; Interrogation_Position=1968; Antisense; AATGTCCATCGGGATCCATGATCAA
>probe:Drosophila_2:1630217_at:663:37; Interrogation_Position=2047; Antisense; ATCTACTTTGTCTACGATCCCAATT

Paste this into a BLAST search page for me
TAATGCTGTATTGCCGCCATATCTGATCTGCACTATGCTTCTGTTGGTGTTGCGTTCCATCACAAAATCGTTCGACGTTGTGTGCCGCATTCTGTAAATATATATTCTCGAACTACAGCCGCATGGATATCATACCACTCAATGCTTTCCGACTACCTGGTCTGAATCTAACGCCTAACGCCGACGCAAATCTTCTTTTTTTCCGCCCAGGAACTGTGTGCTGAAGTGTGCTGAATCGAACTACTTGGGCGATACAAACGCTCCCGAATTCGATAATATATTGGGTTGGCTCGTTGCCCAAATGTCCATCGGGATCCATGATCAAATCTACTTTGTCTACGATCCCAATT

Full Affymetrix probeset data:

Annotations for 1630217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720