FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630218_at:

>probe:Drosophila_2:1630218_at:215:535; Interrogation_Position=138; Antisense; GGTGCAGGAGAAACCAAGCTCTATT
>probe:Drosophila_2:1630218_at:536:127; Interrogation_Position=150; Antisense; ACCAAGCTCTATTCAGCTGCTGGAC
>probe:Drosophila_2:1630218_at:674:619; Interrogation_Position=167; Antisense; TGCTGGACGCCGGAGAAACGGCCCA
>probe:Drosophila_2:1630218_at:343:391; Interrogation_Position=181; Antisense; GAAACGGCCCAGTCTGATTCCACAG
>probe:Drosophila_2:1630218_at:242:461; Interrogation_Position=196; Antisense; GATTCCACAGACGAGAACGTTAGGA
>probe:Drosophila_2:1630218_at:198:199; Interrogation_Position=211; Antisense; AACGTTAGGAAAGTGCGCCAGTACT
>probe:Drosophila_2:1630218_at:272:171; Interrogation_Position=220; Antisense; AAAGTGCGCCAGTACTTTGGACCAC
>probe:Drosophila_2:1630218_at:190:255; Interrogation_Position=229; Antisense; CAGTACTTTGGACCACCACCGTTTG
>probe:Drosophila_2:1630218_at:3:715; Interrogation_Position=322; Antisense; TTCGGCGGTGGTTTCCAGAGAACTC
>probe:Drosophila_2:1630218_at:350:101; Interrogation_Position=338; Antisense; AGAGAACTCGAGTGGTCACCCGCAC
>probe:Drosophila_2:1630218_at:43:673; Interrogation_Position=37; Antisense; TACGACATCGAAATGGATCACAAGT
>probe:Drosophila_2:1630218_at:174:655; Interrogation_Position=65; Antisense; TAATATTTTTCTTCAGCATTGCTGC
>probe:Drosophila_2:1630218_at:398:7; Interrogation_Position=82; Antisense; ATTGCTGCTCTGCTCTTATGCAATT
>probe:Drosophila_2:1630218_at:27:55; Interrogation_Position=99; Antisense; ATGCAATTTTGTTAGAGCCGATGAA

Paste this into a BLAST search page for me
GGTGCAGGAGAAACCAAGCTCTATTACCAAGCTCTATTCAGCTGCTGGACTGCTGGACGCCGGAGAAACGGCCCAGAAACGGCCCAGTCTGATTCCACAGGATTCCACAGACGAGAACGTTAGGAAACGTTAGGAAAGTGCGCCAGTACTAAAGTGCGCCAGTACTTTGGACCACCAGTACTTTGGACCACCACCGTTTGTTCGGCGGTGGTTTCCAGAGAACTCAGAGAACTCGAGTGGTCACCCGCACTACGACATCGAAATGGATCACAAGTTAATATTTTTCTTCAGCATTGCTGCATTGCTGCTCTGCTCTTATGCAATTATGCAATTTTGTTAGAGCCGATGAA

Full Affymetrix probeset data:

Annotations for 1630218_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720