Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630219_at:

>probe:Drosophila_2:1630219_at:219:707; Interrogation_Position=2227; Antisense; TTACCGCACAGAGATCGCAGTCCGA
>probe:Drosophila_2:1630219_at:123:399; Interrogation_Position=2317; Antisense; GACACTCCAAAAGCTGTTGTTTCCA
>probe:Drosophila_2:1630219_at:244:215; Interrogation_Position=2347; Antisense; AAGATGTTATCACCACCGATTTCCA
>probe:Drosophila_2:1630219_at:369:19; Interrogation_Position=2365; Antisense; ATTTCCAGGGCTTCCAGCGCTAAAT
>probe:Drosophila_2:1630219_at:625:339; Interrogation_Position=2383; Antisense; GCTAAATCCTCAGACAGCAGCAATT
>probe:Drosophila_2:1630219_at:716:607; Interrogation_Position=2429; Antisense; TGAGCAGTCTGAATACACCTAGTAT
>probe:Drosophila_2:1630219_at:455:29; Interrogation_Position=2452; Antisense; ATAAAGTCCTTTACTCAGTCACCGG
>probe:Drosophila_2:1630219_at:186:281; Interrogation_Position=2465; Antisense; CTCAGTCACCGGATCAAGTTGTTAT
>probe:Drosophila_2:1630219_at:162:439; Interrogation_Position=2515; Antisense; GAGGCTGCGCTAGCCAGACTGGAAA
>probe:Drosophila_2:1630219_at:312:609; Interrogation_Position=2543; Antisense; TGAGAGGATCAACGGCCACATTGCA
>probe:Drosophila_2:1630219_at:30:667; Interrogation_Position=2604; Antisense; TACAGCCTCCTTACTAAGTTCTCGA
>probe:Drosophila_2:1630219_at:281:405; Interrogation_Position=2627; Antisense; GACGTACCTCTCCTTGGGTTATGAG
>probe:Drosophila_2:1630219_at:545:431; Interrogation_Position=2704; Antisense; GAGTCTCTGGAAACTCCACAGGCCA
>probe:Drosophila_2:1630219_at:55:383; Interrogation_Position=2743; Antisense; GAACGCTGCGATATTTGCTACAATG

Paste this into a BLAST search page for me
TTACCGCACAGAGATCGCAGTCCGAGACACTCCAAAAGCTGTTGTTTCCAAAGATGTTATCACCACCGATTTCCAATTTCCAGGGCTTCCAGCGCTAAATGCTAAATCCTCAGACAGCAGCAATTTGAGCAGTCTGAATACACCTAGTATATAAAGTCCTTTACTCAGTCACCGGCTCAGTCACCGGATCAAGTTGTTATGAGGCTGCGCTAGCCAGACTGGAAATGAGAGGATCAACGGCCACATTGCATACAGCCTCCTTACTAAGTTCTCGAGACGTACCTCTCCTTGGGTTATGAGGAGTCTCTGGAAACTCCACAGGCCAGAACGCTGCGATATTTGCTACAATG

Full Affymetrix probeset data:

Annotations for 1630219_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime