FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630221_at:

>probe:Drosophila_2:1630221_at:471:251; Interrogation_Position=1032; Antisense; CAAGGCGGTGTTGCATGACGTTGTT
>probe:Drosophila_2:1630221_at:189:185; Interrogation_Position=1062; Antisense; AAAATGGAGCCACTCGGACTTTCTG
>probe:Drosophila_2:1630221_at:137:639; Interrogation_Position=1075; Antisense; TCGGACTTTCTGTTCGCCAAATTAA
>probe:Drosophila_2:1630221_at:31:303; Interrogation_Position=617; Antisense; CCGCCGTTTTCATGAAGCACGCAAG
>probe:Drosophila_2:1630221_at:222:699; Interrogation_Position=697; Antisense; TTTTTTGGCCCCTTAGATGCTATAA
>probe:Drosophila_2:1630221_at:343:341; Interrogation_Position=715; Antisense; GCTATAAGATTCCTGCTATCCGTTT
>probe:Drosophila_2:1630221_at:702:339; Interrogation_Position=729; Antisense; GCTATCCGTTTTTTGCAAATGCTCG
>probe:Drosophila_2:1630221_at:261:5; Interrogation_Position=765; Antisense; ATTGTGCGCCTTTATGTTCATATTG
>probe:Drosophila_2:1630221_at:293:579; Interrogation_Position=789; Antisense; GGCCAGTGAAGAACCAACATCGTAT
>probe:Drosophila_2:1630221_at:517:209; Interrogation_Position=826; Antisense; AAGCACTTTCTTCAACTCCGGAAAT
>probe:Drosophila_2:1630221_at:646:557; Interrogation_Position=853; Antisense; GGAAAATTCCGTCCGTATGACTTCG
>probe:Drosophila_2:1630221_at:95:89; Interrogation_Position=950; Antisense; AGTCGCCCATTCATATATACCACAG
>probe:Drosophila_2:1630221_at:453:687; Interrogation_Position=965; Antisense; TATACCACAGCCATGGTGACGACTT
>probe:Drosophila_2:1630221_at:560:609; Interrogation_Position=981; Antisense; TGACGACTTGGTGGCGCGCAAAGAC

Paste this into a BLAST search page for me
CAAGGCGGTGTTGCATGACGTTGTTAAAATGGAGCCACTCGGACTTTCTGTCGGACTTTCTGTTCGCCAAATTAACCGCCGTTTTCATGAAGCACGCAAGTTTTTTGGCCCCTTAGATGCTATAAGCTATAAGATTCCTGCTATCCGTTTGCTATCCGTTTTTTGCAAATGCTCGATTGTGCGCCTTTATGTTCATATTGGGCCAGTGAAGAACCAACATCGTATAAGCACTTTCTTCAACTCCGGAAATGGAAAATTCCGTCCGTATGACTTCGAGTCGCCCATTCATATATACCACAGTATACCACAGCCATGGTGACGACTTTGACGACTTGGTGGCGCGCAAAGAC

Full Affymetrix probeset data:

Annotations for 1630221_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720