FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630223_at:

>probe:Drosophila_2:1630223_at:626:193; Interrogation_Position=1006; Antisense; AACTCTCTTGGTGTCTATTTATGGG
>probe:Drosophila_2:1630223_at:552:165; Interrogation_Position=1038; Antisense; AAATGATTCAACTTCCTAGGTAGAG
>probe:Drosophila_2:1630223_at:113:149; Interrogation_Position=1048; Antisense; ACTTCCTAGGTAGAGTGCTTCTTAA
>probe:Drosophila_2:1630223_at:602:623; Interrogation_Position=1134; Antisense; TGCCGTCGATATATAAGCTGTGTAC
>probe:Drosophila_2:1630223_at:696:119; Interrogation_Position=1149; Antisense; AGCTGTGTACGTGTCAATCTAGTTT
>probe:Drosophila_2:1630223_at:506:63; Interrogation_Position=1197; Antisense; ATGTGGCTAAGATTCCATGCGAAAT
>probe:Drosophila_2:1630223_at:610:169; Interrogation_Position=1232; Antisense; AAAGGCGTTCTTCGCGTAACGAGCA
>probe:Drosophila_2:1630223_at:670:717; Interrogation_Position=1242; Antisense; TTCGCGTAACGAGCATAAACATAGT
>probe:Drosophila_2:1630223_at:43:165; Interrogation_Position=1299; Antisense; AAATACTCCAAACTACACATTCTTT
>probe:Drosophila_2:1630223_at:117:679; Interrogation_Position=807; Antisense; TAGATTCTCGTAGGTGGTCGGCCCA
>probe:Drosophila_2:1630223_at:178:591; Interrogation_Position=821; Antisense; TGGTCGGCCCAGTGCAAGAATAAGT
>probe:Drosophila_2:1630223_at:5:659; Interrogation_Position=909; Antisense; TAAGCAGTCGCTAGTTTTCAAATCG
>probe:Drosophila_2:1630223_at:552:657; Interrogation_Position=950; Antisense; TAAGTCAAACTATTCTACATGCTAT
>probe:Drosophila_2:1630223_at:84:697; Interrogation_Position=997; Antisense; TTTACCAACAACTCTCTTGGTGTCT

Paste this into a BLAST search page for me
AACTCTCTTGGTGTCTATTTATGGGAAATGATTCAACTTCCTAGGTAGAGACTTCCTAGGTAGAGTGCTTCTTAATGCCGTCGATATATAAGCTGTGTACAGCTGTGTACGTGTCAATCTAGTTTATGTGGCTAAGATTCCATGCGAAATAAAGGCGTTCTTCGCGTAACGAGCATTCGCGTAACGAGCATAAACATAGTAAATACTCCAAACTACACATTCTTTTAGATTCTCGTAGGTGGTCGGCCCATGGTCGGCCCAGTGCAAGAATAAGTTAAGCAGTCGCTAGTTTTCAAATCGTAAGTCAAACTATTCTACATGCTATTTTACCAACAACTCTCTTGGTGTCT

Full Affymetrix probeset data:

Annotations for 1630223_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720