FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630224_at:

>probe:Drosophila_2:1630224_at:308:37; Interrogation_Position=1001; Antisense; ATCTTCGTCAACTCAGTGATGGCCA
>probe:Drosophila_2:1630224_at:649:195; Interrogation_Position=1047; Antisense; AACTGGTTCGGGAGTTCTTCTGCCT
>probe:Drosophila_2:1630224_at:470:315; Interrogation_Position=1081; Antisense; GCCTTCGTACTCTGAATCCATGGAG
>probe:Drosophila_2:1630224_at:125:139; Interrogation_Position=1176; Antisense; ACGATCTCATTCTCAGTTTGCAGCA
>probe:Drosophila_2:1630224_at:241:307; Interrogation_Position=1281; Antisense; CCTCAGCTAGCGACAGTTTGGGAAT
>probe:Drosophila_2:1630224_at:114:201; Interrogation_Position=743; Antisense; AACGCTGTGCTAAGGGTGCCCATTA
>probe:Drosophila_2:1630224_at:477:143; Interrogation_Position=803; Antisense; ACTGCCTACAAGCTGCGAGTCGAGA
>probe:Drosophila_2:1630224_at:115:423; Interrogation_Position=824; Antisense; GAGAATCCGGAGACCAACGACTATT
>probe:Drosophila_2:1630224_at:290:3; Interrogation_Position=846; Antisense; ATTGGCTTGTTATGCGACGCTACAC
>probe:Drosophila_2:1630224_at:81:403; Interrogation_Position=872; Antisense; GACTTCGTGCGGCTCAATAGCAAGC
>probe:Drosophila_2:1630224_at:381:1; Interrogation_Position=931; Antisense; GCCCCGGAAGAAGCTTTTCGGCGAT
>probe:Drosophila_2:1630224_at:629:453; Interrogation_Position=953; Antisense; GATAACTTCAATGCCGTCTTTCTCG
>probe:Drosophila_2:1630224_at:546:497; Interrogation_Position=968; Antisense; GTCTTTCTCGACAATCGGGTGCAAG
>probe:Drosophila_2:1630224_at:9:617; Interrogation_Position=987; Antisense; TGCAAGGTCTGCAGATCTTCGTCAA

Paste this into a BLAST search page for me
ATCTTCGTCAACTCAGTGATGGCCAAACTGGTTCGGGAGTTCTTCTGCCTGCCTTCGTACTCTGAATCCATGGAGACGATCTCATTCTCAGTTTGCAGCACCTCAGCTAGCGACAGTTTGGGAATAACGCTGTGCTAAGGGTGCCCATTAACTGCCTACAAGCTGCGAGTCGAGAGAGAATCCGGAGACCAACGACTATTATTGGCTTGTTATGCGACGCTACACGACTTCGTGCGGCTCAATAGCAAGCGCCCCGGAAGAAGCTTTTCGGCGATGATAACTTCAATGCCGTCTTTCTCGGTCTTTCTCGACAATCGGGTGCAAGTGCAAGGTCTGCAGATCTTCGTCAA

Full Affymetrix probeset data:

Annotations for 1630224_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720