Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630226_at:

>probe:Drosophila_2:1630226_at:689:705; Interrogation_Position=3430; Antisense; TTATGGAAGACGATGTTGAACCGTT
>probe:Drosophila_2:1630226_at:289:465; Interrogation_Position=3444; Antisense; GTTGAACCGTTTTAACAGCTCCACA
>probe:Drosophila_2:1630226_at:602:613; Interrogation_Position=3446; Antisense; TGAACCGTTTTAACAGCTCCACAGT
>probe:Drosophila_2:1630226_at:263:127; Interrogation_Position=3449; Antisense; ACCGTTTTAACAGCTCCACAGTATT
>probe:Drosophila_2:1630226_at:373:477; Interrogation_Position=3452; Antisense; GTTTTAACAGCTCCACAGTATTCCC
>probe:Drosophila_2:1630226_at:139:471; Interrogation_Position=3479; Antisense; GTTCCCATTAACAAACCTGACTTCA
>probe:Drosophila_2:1630226_at:569:709; Interrogation_Position=3486; Antisense; TTAACAAACCTGACTTCATCTCGCC
>probe:Drosophila_2:1630226_at:333:301; Interrogation_Position=3509; Antisense; CCCAGCACAATCTCCCATAATATAT
>probe:Drosophila_2:1630226_at:147:239; Interrogation_Position=3517; Antisense; AATCTCCCATAATATATTACGCTCA
>probe:Drosophila_2:1630226_at:216:687; Interrogation_Position=3531; Antisense; TATTACGCTCATATCCATAACTTTA
>probe:Drosophila_2:1630226_at:214:337; Interrogation_Position=3537; Antisense; GCTCATATCCATAACTTTAAGTCGA
>probe:Drosophila_2:1630226_at:279:277; Interrogation_Position=3551; Antisense; CTTTAAGTCGAAACATATTGCTAAT
>probe:Drosophila_2:1630226_at:589:719; Interrogation_Position=3568; Antisense; TTGCTAATAAATAACGCCGCACTTA
>probe:Drosophila_2:1630226_at:97:339; Interrogation_Position=3570; Antisense; GCTAATAAATAACGCCGCACTTAAT

Paste this into a BLAST search page for me
TTATGGAAGACGATGTTGAACCGTTGTTGAACCGTTTTAACAGCTCCACATGAACCGTTTTAACAGCTCCACAGTACCGTTTTAACAGCTCCACAGTATTGTTTTAACAGCTCCACAGTATTCCCGTTCCCATTAACAAACCTGACTTCATTAACAAACCTGACTTCATCTCGCCCCCAGCACAATCTCCCATAATATATAATCTCCCATAATATATTACGCTCATATTACGCTCATATCCATAACTTTAGCTCATATCCATAACTTTAAGTCGACTTTAAGTCGAAACATATTGCTAATTTGCTAATAAATAACGCCGCACTTAGCTAATAAATAACGCCGCACTTAAT

Full Affymetrix probeset data:

Annotations for 1630226_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime