Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630229_at:

>probe:Drosophila_2:1630229_at:492:429; Interrogation_Position=100; Antisense; GAGTTCACCCGCGTCTCTGGATATG
>probe:Drosophila_2:1630229_at:220:125; Interrogation_Position=134; Antisense; AGCGCCACGAGCTGGTGCTGCTGAA
>probe:Drosophila_2:1630229_at:510:507; Interrogation_Position=148; Antisense; GTGCTGCTGAATGATACGCTGCTGC
>probe:Drosophila_2:1630229_at:226:617; Interrogation_Position=185; Antisense; TGCAGAACATGGTGCTGTACCCCAG
>probe:Drosophila_2:1630229_at:228:551; Interrogation_Position=213; Antisense; GGAGTACGGCCAGTACCAGCAGCGA
>probe:Drosophila_2:1630229_at:564:107; Interrogation_Position=311; Antisense; AGAACGCGGCATTTTTGCTCAGCAG
>probe:Drosophila_2:1630229_at:375:273; Interrogation_Position=393; Antisense; CATTTTGTCCCTCGGCGATAGCCAA
>probe:Drosophila_2:1630229_at:529:425; Interrogation_Position=433; Antisense; GAGAGCACGTATCCCATGTTCAGCT
>probe:Drosophila_2:1630229_at:705:503; Interrogation_Position=461; Antisense; GTCCGCTGATCGACAGCATTTTCGA
>probe:Drosophila_2:1630229_at:64:429; Interrogation_Position=484; Antisense; GAGATTCCAATTTCGACGCTGCGTG
>probe:Drosophila_2:1630229_at:447:409; Interrogation_Position=498; Antisense; GACGCTGCGTGCTGTTAACAACCTG
>probe:Drosophila_2:1630229_at:565:703; Interrogation_Position=512; Antisense; TTAACAACCTGGTGGGTCGCCTGAC
>probe:Drosophila_2:1630229_at:722:83; Interrogation_Position=564; Antisense; AGTGTCGCAAAAATCCGTGGCAGCT
>probe:Drosophila_2:1630229_at:431:45; Interrogation_Position=635; Antisense; ATCCCAGTGGGCAACGGATGCGCGA

Paste this into a BLAST search page for me
GAGTTCACCCGCGTCTCTGGATATGAGCGCCACGAGCTGGTGCTGCTGAAGTGCTGCTGAATGATACGCTGCTGCTGCAGAACATGGTGCTGTACCCCAGGGAGTACGGCCAGTACCAGCAGCGAAGAACGCGGCATTTTTGCTCAGCAGCATTTTGTCCCTCGGCGATAGCCAAGAGAGCACGTATCCCATGTTCAGCTGTCCGCTGATCGACAGCATTTTCGAGAGATTCCAATTTCGACGCTGCGTGGACGCTGCGTGCTGTTAACAACCTGTTAACAACCTGGTGGGTCGCCTGACAGTGTCGCAAAAATCCGTGGCAGCTATCCCAGTGGGCAACGGATGCGCGA

Full Affymetrix probeset data:

Annotations for 1630229_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime