Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630231_at:

>probe:Drosophila_2:1630231_at:67:531; Interrogation_Position=4107; Antisense; GGGATTTCCGTCAGATAGAGATCGA
>probe:Drosophila_2:1630231_at:636:723; Interrogation_Position=4272; Antisense; TTGAGTTACTCGTAGTTCGCCTAAA
>probe:Drosophila_2:1630231_at:234:17; Interrogation_Position=4296; Antisense; ATTTTAAAACTTGCTCACCCTGCGC
>probe:Drosophila_2:1630231_at:563:133; Interrogation_Position=4312; Antisense; ACCCTGCGCACATGTACACTGTAGC
>probe:Drosophila_2:1630231_at:438:487; Interrogation_Position=4332; Antisense; GTAGCCCCTACGCATGACATAGGTC
>probe:Drosophila_2:1630231_at:662:679; Interrogation_Position=4351; Antisense; TAGGTCTATCCATATACCGCATAAT
>probe:Drosophila_2:1630231_at:132:237; Interrogation_Position=4452; Antisense; AATCGATGTACCTACTCTGCAGTCC
>probe:Drosophila_2:1630231_at:160:669; Interrogation_Position=4464; Antisense; TACTCTGCAGTCCATGTACTGAAAT
>probe:Drosophila_2:1630231_at:54:489; Interrogation_Position=4479; Antisense; GTACTGAAATCGTGACTTGTCGCGT
>probe:Drosophila_2:1630231_at:55:145; Interrogation_Position=4493; Antisense; ACTTGTCGCGTAGGAATTTTGGATC
>probe:Drosophila_2:1630231_at:51:363; Interrogation_Position=4506; Antisense; GAATTTTGGATCACGAGCCGAAAGA
>probe:Drosophila_2:1630231_at:359:617; Interrogation_Position=4533; Antisense; TGCACTCCATATTCATACTCGTATT
>probe:Drosophila_2:1630231_at:177:703; Interrogation_Position=4625; Antisense; TTATGCAATGTGTAAGAACTCGCCA
>probe:Drosophila_2:1630231_at:222:383; Interrogation_Position=4640; Antisense; GAACTCGCCAATGTGTGTAATGTAA

Paste this into a BLAST search page for me
GGGATTTCCGTCAGATAGAGATCGATTGAGTTACTCGTAGTTCGCCTAAAATTTTAAAACTTGCTCACCCTGCGCACCCTGCGCACATGTACACTGTAGCGTAGCCCCTACGCATGACATAGGTCTAGGTCTATCCATATACCGCATAATAATCGATGTACCTACTCTGCAGTCCTACTCTGCAGTCCATGTACTGAAATGTACTGAAATCGTGACTTGTCGCGTACTTGTCGCGTAGGAATTTTGGATCGAATTTTGGATCACGAGCCGAAAGATGCACTCCATATTCATACTCGTATTTTATGCAATGTGTAAGAACTCGCCAGAACTCGCCAATGTGTGTAATGTAA

Full Affymetrix probeset data:

Annotations for 1630231_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime